Non-nodulating Enterobacter strains with multiple Plant Growth Promoting (PGP) attributes dominantly co-exist with nodulating rhizobia as root nodule endophytes of wild perennial legumes, Tephrosia spp. of Indian Thar Desert

Introduction

Endophytic bacteria typically enter plants by root hairs, epidermal junctions, and areas of damaged tissue. In addition to N-fixing rhizobia, a wide range of non-nodulating endophytic bacteria find an attractive niche in the root nodules of leguminous plants because they offer a confined protective environment for microbes and a plentiful source of nutrients. Large numbers of non-nodulating opportunistic root nodule endophytes such as species of Burkholderia, Chryseobacterium, Chryseomonas, Cronobacter, Curtobacterium, Enterobacter, Erwinia, Escheritia, Flavimonas, Herbaspirillum, Arthrobacter, Acinetobacter, Achromobacter, Aerobacter, Aeromonas, Agrobacterium, Bacillus, Kocuria, LysiniBacillus, Novosphingobium, PaeniBacillus, Mycobacterium, Microbacterium, Micrococcus, Paracoccus, Pseudomonas, Serratia, Rahnella, Staphylococcus, Stenotrophomonas, ThioBacillus, Xanthomonas, Variovorax, Sphingobacterium, Sphingomonas and many more (De Meyer et al., 2015; Hnini and Aurag 2024) [11,22] have been isolated both from wild and crop legumes e.g. Sphaerophysa salsula (Deng et al., 2011) [12] ; species of Crotalaria and Indigofera, Erythrina brucei (Aserse et al., 2013) [3] ; Colophospermum mopane (Burbano et al., 2015) [6] ; Abrus precatorius (Ghosh et al., 2015) [18] ; Vigna unguiculata (Leite et al., 2017; Muindi et al., 2021) [31,37] ; Glycine max (Zhao et al., 2018) [64] ; Mimosa pudica (Sánchez-Cruz et al., 2019) [49] ; Lupinus albus (Ferchichi et al., 2019) [16] ; Phaseolus lunatus (Chibeba et al., 2020) [10] ; Lens culinaris (Jabborova et al., 2021) [26] ; Trifolium repense (Rahal and Chekireb 2021) [43] and Arachis hypogaea (Hossain et al., 2023) [23] . It has been found that even human pathogens may live temporarily in plants as endophytes, and through a variety of direct or indirect methods, their interactions with the host plant can be either neutral or beneficial (Tyler and Triplett 2008) [60] . Free-living, commensal, and pathogenic bacteria belonging to the Enterobacteriaceae family are linked to host species that range from humans to plants. To date, a number of nonpathogenic Enterobacteriaceae members have been isolated from wild or cultivated plants (Markova et al., 2005; Kan et al., 2007; Torres et al., 2008; Burbano et al., 2015; Ghosh et al., 2015; Hnini and Aurag 2024) [6,33,18,28,22] . Benhizia et al. (2004) [4] published the first report of Gamma-proteobacteria association to legume nodules. Enterobacter cloacae and E. kobei were isolated from root nodules of three species of Hedysarum (H. carnosum, H. spinosissimum and H. pallidum) growing in Algeria (Benhizia et al., 2004) [4] . Enterobacter agglomerans was detected within nodules of H. spinosissimum by immunofluorescence microscopy (Muresu et al., 2008) [38] . Role of endophytic Enterobacteria as alternative nitrogen fixing symbionts and inducers of nodule organogenesis however seems to be ruled out by the evidence such as the incapacity of pure cultures to nodulate the legume under axenic conditions (Muresu et al., 2008) [38] . Two strains isolated from H. pallidum and H. spinosissimum were subjected to microarray analysis utilizing oligonucleotides for the nodC and nifH genes (Bontemps et al., 2005) [5] in an attempt to find nodulation and nitrogen fixation genes in Gamma-proteobacteria. However, none of these genes were found. But in Tunisia, Zakhia et al. (2006) [63] discovered a variety of bacteria associated with legume root nodules and discovered a nifH-like gene in the genera Microbacterium and Starkeya. Plant growth promoting (PGP) bacteria are thought to work by a number of methods, such as the solubilization of phosphate, production of phytohormones and siderophores, etc. Through the non-symbiotic fixation of nitrogen, these bacteria can also enhance plant growth. Certain bacteria that produce hydrolyzing enzymes, such as chitinases and glucanases, act as biocontrol agents. More than two or three PGP features, which either directly or indirectly or cooperatively support plant growth, may be displayed by the bacterial strains. For this reason, potential PGP bacteria are screened in vitro for multiple PGP traits. Such types of studies have not been done previously on bacterial endophytes in root nodules of wild leguminous plants of arid regions of Indian Thar Desert therefore an attempt was made to explore such possibility for bacterial endophytes of Tephrosia spp. Making consortium of such useful bacteria looks attractive for wide agricultural application in the future. However, the significance of these non-rhizobial root nodule bacterial endophytes has yet to be realized.

Materials and Methods Isolation, phenotypic and biochemical characterization of bacterial root nodule endophytes

Isolation and purification of bacteria from root nodules of Tephrosia species was done as described in Somasegaran and Hoben (1994) [52] . To ensure that only endophytes and no surface bacteria are isolated the nodules were swapped on Congo-red (CR)-Yeast Extract Mannitol Agar (YEMA) plates before puncturing them. Pure bacterial strains were analyzed for phenotypic traits such as salt, pH and temperature tolerance as per Tak et al. (2020). HiMedia discs for carbohydrate fermentation were used to determine the bacteria's carbon utilization patterns, and the Kirby Boyer disc diffusion test was used to determine the inherent antibiotic resistance profiles (Cappuccino and Sherman 2007) [7] . Numerous biochemical assays, including those for nitrate reductase activity, citrate utilization, methyl-red, Voges-Proskauer, gelatinase, catalase, and amylase synthesis, were conducted (Cappuccino and Sherman 2007) [7] . O-nitrophenyl-β-D-galactopyranoside (ONPG) test was carried using HiMedia ONPG discs; oxidase activity was tested with HiMedia oxidase discs and hydrogen sulfide production using HiMedia Lead acetate strips.

Screening of bacterial strains for hydrolytic enzyme production and characteristics that promote plant growth

The standard procedures for ammonia production (Cappuccino and Sherman 2007) [7] , IAA production (Gordon and Weber 1951) [19] , siderophore production (Schwyn and Neilands 1987) [50] , HCN production (Bakker and Schippers 1987), phosphate solubilization (Pikovskaya 1948) [42] , and phytase activity (Howson and Davis 1983) [24] were used to screen the root nodule bacterial endophytes for a variety of PGP traits. Ability of strains to produce some hydrolytic enzymes was also tested using the methods as described by Smibert and Krieg (1994) [51] for protease activity; Ramesh et al. (2008) [44] for cellulase activity; Kim et al. (2003) [29] for chitinase activity; and Ronald and James (2006) [47] for pectinase activity.

Analyzing the genetic diversity, amplification and sequencing of 16S ribosomal RNA gene of root nodule endophytes

To analyze the genetic diversity among the strains the RPO1 primer, as described by Richardson et al. (1995) [46] was used, the PCR mix and thermal cycling conditions used were as stated by Tak et al. (2020). Using the primers 18F (AGAGTTTGATCCTGGCTCAG) and 1492R (CTACGGCTACCTTGTTACG) described by Weisburg et al. (1991) [61] the intragenic segment of 1475 bp from the 16S rRNA gene was amplified in selective bacterial strains. PCR thermal cycling conditions were 5 min. initial denaturation at 95 ºC followed by 35 cycles (1 min. 94 ºC, 1 min. 53 ºC, 1 min. 72 ºC) and final extension of 7 min. at 72 ºC. A 0.8% (w/v) agarose gel prepared in pH 8.0 1X TAE buffer was then used for gel electrophoresis of the amplified 16S rRNA products. Sybr Safe was used to pre-stain the gels (8 µl/100 ml). The amplified products were run with a 1 Kb DNA ladder (Promega). For one hour, electrophoresis was performed at 80 V. A UV transilluminator was used to see the gels, and a gel documentation system was used to take digital pictures of the gels. The QIAGEN-QIAquick PCR Purification Kit was used to purify the amplified PCR products. Both 18F and 1492R primers were used for sequencing of 16S rRNA gene using the Applied Biosystems Big Dye version 3.1 terminator.

Analysis of sequences and submission to NCBI GenBank

The GENETOOL software [GeneTool Lite version 1.0 Double Twist Inc., Oakland, CA, USA] was used to evaluate the ABI files that were acquired from the sequencing company. EzBioCloud (Chalita et al., 2024) [8] , a platform for analyzing the taxonomic hierarchy of bacteria through quality controlled sequences of the 16S rRNA gene, and the NCBI-BLASTN tool (Altschul et al., 1990) [1] were used for sequence similarity searches after the sequences had been edited, trimmed, and assembled.

Using the SEQUIN software (www.ncbi.nlm.nih.gov/Sequin), sequences were uploaded to NCBI GenBank in order to receive accession numbers.

Phylogenetic analysis

Molecular Evolutionary Genetics Analysis (MEGA7) software was used for phylogenetic analysis (Kumar et al., 2016). The FASTA sequences of the Enterobacter strains from this investigation and bacteria that shared similarities according to EzBioCloud were aligned using ClustalW in MEGA7 for molecular phylogenetic analysis based on 16S rRNA gene sequences. Every position with lacking information or gaps was removed. The Maximum Likelihood approach, which is based on the General Time Reversible model, was used to infer the evolutionary history.

Results and Discussion

Diversity of bacterial root nodule endophytes of Tephrosia spp.

In the Indian Thar Desert perennial wild legumes of genus Tephrosia (sub-family Papilionoideae) is represented by nodulating species such as T. wallichii, T. purpurea, T. villosa, T. falciformis, T. leptostachya, T. subtriflora and T. uniflora (Panwar et al., 2014) [40] . Detailed sampling, nodulation studies, characterization and molecular identification of rhizobia associated with root nodules were done for T. leptostachya, T. purpurea, T. villosa, T. falciformis, and T. wallichii (Tak 2012). The rhizobial microsymbionts associated with these species were identified at molecular level and characterized ( [17,54,39] . The dominant nodulating endophytes isolated from these species of Tephrosia were fast-growing strains of Sinorhizobium/Ensifer (Gehlot et [17] . In addition fast-growing Sinorhizobium/Ensifer, slow-growing Bradyrhizobium strains were also isolated from Tephrosia spp. (Tak 2012; Gehlot et al., 2012; Tak and Gehlot 2019) [17,54] Multiple studies confirm these genera as the most prevalent non-rhizobial endophytic bacteria. This suggests that even if these nonrhizobial populations do not cause nodule formation, their frequency is linked to a number of characteristics that promote plant growth (Hnini and Aurag 2024) [22] .

Biochemical

and physiological characteristics of Enterobacter strains Eight (JNVU TF1, JNVU TF6, JNVU TF11, JNVU TF18, JNVU TF19, JNVU TW3, JNVU TW4 and JNVU TW6) fast growing Enterobacterial strains isolated from T. falciformis and T. wallichii were characterised at phenotypic (NaCl, pH and temperature tolerance) level (Table 1). Up to 3% (w/v) NaCl, these Enterobacter strains can withstand, two strains JNVU TF1, and JNVU TF11 could grow up to 4%. Strains JNVU TF1, JNVU TF11, JNVU TW3, JNVU TW4 and JNVU TW6 were capable of growing in a broad pH range of 4.5-11. Rhizobium tropici CIAT899 was isolated from bean nodules by Graham et al. (1994) [29] and was able to thrive on YEMA medium with a pH of 4.0. Tested eight strains turned the color of the Bromo Thymol Blue (BTB) media yellow due to production of acids. These eight Enterobacterial strains utilized most of the sugars except adonitol, dulcitol, inulin and salicin that were metabolized by only few strains (Fig. 1). These Enterobacterial strains were sensitive to most of the antibiotics tested and resistant to different concentrations of Nitrofurantoin, Ampicillin, Augmentin, Cephoxitin and Cephalothin (Table 2). In bacteria, horizontal gene transfer plays a significant role in evolution and is a potent driver of phenotypic, biochemical, and genetic variety. Several biochemical tests were performed on the eight strains from this study (Table 1). It was observed that all tested strains displayed color changes (to red precipitate) upon the addition of reagents alpha-naphthylamine and sulfanilic acid, indicating positive nitrate reductase activity. (Table 1). Five of tested strains could hydrolyze the protein polymer, gelatin, to amino acids (Table 1). These results are comparable with results of Farmer et al. (1980) [14] . Further all strains were found to in vitro utilize citrate as the sole source of carbon. Members of genera belonging to the Enterobacteriaceae family are well known to use citrate in the medium (Farmer et al. 1980, 1985) [14, 15] . However all tested Enterobacterial strains could enzymatically liberate sulfur from sulfur-containing compounds and turned the lead acetate strip black which is contrary with results obtained by Farmer et al. (1980, 1985) [14,15] . Most of the characters/traits mentioned above are related to catabolism and are mostly present on plasmids and are prone to horizontal transfer and therefore can be added or lost in the course of evolution at particular place.

Plant growth-promoting (PGP) traits of Enterobacter strains

Plant growth-promoting endophytic, diazotrophic non-rhizobial bacteria such as Enterobacter cloacae, Enterobacter ludwigii, Klebsiella pneumoniae, Klebsiella variicola and Pseudomonas aeruginosa are commonly isolated from leguminous crops such as Vigna spp. (V. radiata, V. mungo, and V. unguiculata), Glycine max and Arachis hypogaea (Zhao et al., 2018; Hossain et al., 2023; Dhole et al., 2016; Hnini and Aurag 2024) [64,22,23] . We tested the eight Enterobacter strains from present study for multiple PGP traits to screen best strains (Table 1). It was interesting finding that the all tested strains could produce ammonia by hydrolysis of peptones (Table 1). In the present study only one (JNVU TF1) of eight tested Enterobacterial strains showed moderate IAA activity. Mehnaz et al. (2001) [34] observed PGP activity of Enterobacter strains in rice and Mirza et al. (2001) [35] showed PGP activity of Enterobacter strains in sugarcane due to production of IAA. It has been demonstrated that Enterobacter cloacae produces auxins that aid in promoting plant growth (Patten and Glick 1996) [41] . Seven of eight tested Enterobacterial strains could form yellow halo zone against dark blue background indicating production of siderophores. Siderophores have been discovered to be produced by gramnegative bacteria such as Enterobacter and Pseudomonas (Tian et al., 2009) [58] . All of the Enterobacterial strains included in the study formed a clear halo zone around the colony on Pikovskaya medium by solubilizing tricalcium phosphate (TCP) present in it. Solubilization index (SI) was 3-6 for these Enterobacterial strains. Four (JNVU TF19, JNVU TW3, JNVU TW4 and JNVU TW6) of eight tested Enterobacterial strains could produce phytase and efficiently mineralize phytate organic form of phosphate. Few studies have identified rhizobacteria that can effectively mineralize phytate. According to reports, the rhizobacteria that produce phytase include Bacillus, Enterobacter, Burkholderia, Serratia, Pseudomonas, and Staphylococcus (Hussin et al., 2007) [25] . All tested strains showed protease activity with strain JNVU TF6 showing maximum activity. Morales et al. (2003) [36] reported proteolytic activity by Enterobacteriaceae strains. Only three of the tested eight Enterobacterial strains showed slight cellulase activity. Similarly, Sami et al. (2008) [48] reported the production of cellulases by Enterobacter cloacae. Cellulose has been shown to be hydrolyzed by Enterobacter sp. from Bombyx mori digestive system (Anand et al., 2010) [2] . All tested eight Enterobacterial strains showed positive pectinase activity. Contrary to our results Enterobacter sp. from B. mori did not hydrolyze pectin (Anand et al., 2010) [2] . Five of eight tested Enterobacterial strains showed slight chitinase activity. In earlier studies by Chernin et al. (1995) [9] chitinolytic Enterobacter agglomerans has been found antagonistic towards fungal plant pathogens.

Genetic diversity and 16S rRNA phylogeny of Enterobacter strains RPO1 DNA-fingerprinting profile (Fig. 2) of eight (JNVU TF1, JNVU TF6, JNVU TF11, JNVU TF18, JNVU TF19, JNVU TW3, JNVU TW4 and JNVU TW6) fast growing Enterobacterial strains isolated from T. falciformis and T. wallichii revealed genetic diversity among bacteria. However strains JNVU TF11, JNVU TF18 and JNVU TF19 had similarity in few bands. Using the 16S rRNA gene sequences and a BLASTN sequence similarity search, non-nodulating root nodule bacterial strains (JNVU TF1, JNVU TF6, JNVU TW3, JNVU TW4 and JNVU TW6) were identified as species of Enterobacter (Table 3). These strains showed high similarities with type strain Enterobacter cloacae sub sp. cloacae strain ATCC 13047T (isolated from human cerebrospinal fluid) (Ren et al., 2010) and Enterobacter cloacae sub sp. dissolvens LMG 2683T isolated from Zea mays, United Kingdom (Hauben et al., 1998). Similarly, in 16S rRNA based maximum likelihood (ML) phylogenetic tree, strain JNVU TF1 clustered with LMG 2683T whereas strains JNVU TF6 and JNVU TW6 clustered close to ATCC 13047T (Fig. 3). Two strains JNVU TW3 and JNVU TW4 from T. wallichii grouped together to form a separate clade within Enterobacter species. These non nodulating strains showed good PGP activity and were found dominant root nodule endophytic strains in falciformis and T. wallichii plants in this investigation. Similar reports have been reported from Coimbatore, Tamil Nadu, India, about Enterobacter arachidis Ah-143T (EU672801), a diazotrophic bacterium that promotes plant growth and was isolated from groundnut rhizosphere soil (Madhaiyan et al., 2010) [32] . Strains JNVU TW3 and JNVU TW4 also exhibited similarities to the type strain Enterobacter radicincitans D5/23T (NR_042982), which was isolated from the winter wheat phyllosphere and is capable of fixing atmospheric nitrogen and producing auxins and cytokinins (Kämpfer et al., 2005) [27] . According to Benhizia et al. (2004) [4] [4]

, nodules in Hedysarum species are not caused by a single species of rhizobia. Surprisingly, they contain a large number of gamma proteobacteria, including Enterobacter kobei, Enterobacter cloacae, Leclercia adecarboxylata, Pantoea agglomerans, Escherichia vulneris, and Pseudomonas sp. This suggests that the only organisms that live in Hedysarum nodules are either members of the Enterobacteriales or Pseudomonadales order. Presence of symbiotic genes if any and their divergence in members of Enterobacteriaceae need to be examined to include them as nodulating. The presence of endophytic Enterobacteria within perfectly healthy plants shows that other positive interactions may be at work, despite the failure of attempts to test Koch's postulates, which calls for determining whether the bacteria can re-nodulate their hosts.

Conclusion

Our findings show that a variety of symbiotic and nodulating bacterial taxa coexist with primarily non-rhizobia in the nodules of wild legumes. The genetic diversity of nodule endophytic bacteria served as a valuable pool for discovering PGP bacteria. The fact that Enterobacter is frequently found in the root nodules of many plants indicates the need for additional molecular research on the signal exchange, colonization of the root nodules, and importance of this gamma-proteobacteria as endophytes in legumes.

Acknowledgement

AcknowledgementsAuthors are thankful to the following funding agencies for financial assistance: University Grants Commission, New Delhi; DBT, Govt. of India and DST-FIST.

References

1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-10.
2. Anand AA, Vennison SJ, Sankar SG, Prabhu DI, Vasan PT, Raghuraman T. Isolation and characterization of bacteria from the gut of Bombyx mori that degrade cellulose, xylan, pectin, and starch and their impact on digestion. J Insect Sci. 2010;10:107.
3. Aserse AA, Räsänen LA, Aseffa F, Hailemariam A, Lindström K. Diversity of sporadic symbionts and nonsymbiotic endophytic bacteria isolated from nodules of woody, shrub, and food legumes in Ethiopia. Appl Microbiol Biotechnol. 2013;97:10117-34.
4. Benhizia Y, Benhizia H, Benguedouar A, Muresu R, Giacomini A, Squartini A. Gamma proteobacteria can nodulate legumes of the genus Hedysarum. Syst Appl Microbiol. 2004;27:462-8.
5. Bontemps C, Golfier G, Gris-Liebe C, Carrere S, Talini L, Boivin-Masson C. Microarray-based detection and typing of the rhizobium nodulation gene nodC: potential of DNA arrays to diagnose biological functions of interest. Appl Environ Microbiol. 2005;71:8042-8.
6. Burbano CS, Grönemeyer JL, Hurek T, Reinhold-Hurek B. Microbial community structure and functional diversity of nitrogen-fixing bacteria associated with Colophospermum mopane. FEMS Microbiol Ecol. 2015;91:30.
7. Chalita M, Kim YO, Park S, Oh HS, Cho JH, Moon J. EzBioCloud: A genome-driven database and platform for microbiome identification and discovery. Int J Syst Evol Microbiol. 2024;74:006421.
8. Chernin L, Ismailov Z, Haran S, Chet I. Chitinolytic Enterobacter agglomerans antagonistic to fungal plant pathogens. Appl Environ Microbiol. 1995;61:1720-6.
9. Chibeba AM, Pereira CS, Antunes JEL, Ribeiro RA, de Almeida Lopes AC, Gomes RLF. Polyphasic characterization of nitrogen-fixing and co-resident bacteria in nodules of Phaseolus lunatus inoculated with soils from Piauí state, Northeast Brazil. Symbiosis. 2020;80:279-92.
10. De Meyer SE, De Beuf K, Vekeman B, Willems A. A large diversity of non-rhizobial endophytes found in legume root nodules in Flanders (Belgium). Soil Biol Biochem. 2015;83:1-11.
11. Deng ZS, Zhao LF, Kong ZY, Yang WQ, Lindström K, Wang ET. Diversity of endophytic bacteria within nodules of Sphaerophysa salsula in different regions of Loess Plateau in China. FEMS Microbiol Ecol. 2011;76:463-75.
12. Dhole A, Shelat H, Vyas R, Jhala Y, Bhange M. Endophytic occupation of legume root nodules by nifH-positive nonrhizobial bacteria, and their efficacy in the groundnut (Arachis hypogaea). Ann Microbiol. 2016;66:1397-407.
13. Farmer JJ III, Asbury MA, Hickman FW, Brenner DJ. The Enterobacteriaceae Study Group. Enterobacter sakazakii: new species of Enterobacteriaceae isolated from clinical specimens. Int J Syst Bacteriol. 1980;30:569-84.
14. Farmer JJ III, Davis BR, Hickman-Brenner FW, McWhorter A, Huntley-Carter GP, Asbury MA, et al. Biochemical identification of new species and biogroups of Enterobacteriaceae isolated from clinical specimens. J Clin Microbiol. 1985;21:46-76.
15. Ferchichi N, Toukabri W, Boularess M, Smaoui A, Mhamdi R, Trabelsi D. Isolation, identification and plant growth promotion ability of endophytic bacteria associated with lupine root nodule grown in Tunisian soil. Arch Microbiol. 2019;201:1333-49.
16. Gehlot HS, Panwar D, Tak N, Tak A, Sankhla IS, Poonar N. Nodulation of legumes from the Thar desert of India and molecular characterization of their rhizobia. Plant Soil. 2012;357:227-43.
17. Ghosh PK, Sen SK, Maiti TK. Production and metabolism of IAA by Enterobacter spp. (Gammaproteobacteria) isolated from root nodules of a legume Abrus precatorius L. Biocatal Agric Biotechnol. 2015;4:296-303.
18. Gordon SA, Weber RP. Colorimetric estimation of indole acetic acid. Plant Physiol. 1951;26:192-5.
19. Graham PH, Ferrey ML, Conroy MJ, Hammer BE. Acid pH tolerance in strains of Rhizobium and Bradyrhizobium and initial studies on the basis acid tolerance of Rhizobium tropici UMR 1899. Can J Microbiol. 1994;40:198-207.
20. Hauben L, Moore ER, Vauterin L, Steenackers M, Mergaert J, Verdonck L. Phylogenetic position of phytopathogens within the Enterobacteriaceae. Syst Appl Microbiol. 1998;21:384-97.
21. Hnini M, Aurag J. Prevalence, diversity and applications potential of nodules endophytic bacteria: a systematic review. Front Microbiol. 2024;15:1386742.
22. Hossain M, Frith C, Bhattacharyya S, Delaune P, Gentry T. Isolation and characterization of bacterial endophytes from small nodules of field-grown Peanut. Microorganisms. 2023;11:1941.
23. Howson SJ, Davis RP. Production of phytate-hydrolysing enzyme by some fungi. Enzyme Microb Technol. 1983;5:377-82.
24. Hussin ASM, Farouk AE, Greiner R, Salleh HM, Ismail AF. Phytate-degrading enzyme production by bacteria isolated from Malaysian soil. World J Microb Biot. 2007;23:165360.
25. Jabborova D, Bozorov T, Li L, Kistaubayeva A, Egamberdieva D. Identification and characterization of endophytic bacteria isolated from root nodules of lentil (Lens culinaris L.) grown on saline soils. Int J Biol Chem. 2021;14:39-46.
26. Kämpfer P, Ruppel S, Remus R. Enterobacter radicincitans sp. nov, a plant growth promoting species of the family Enterobacteriaceae. Syst Appl Microbiol. 2005;28:213-21.
27. Kan FL, Chen ZY, Wang ET, Tian CF, Sui XH, Chen WX. Characterization of symbiotic and endophytic bacteria isolated from root nodules of herbaceous legumes grown in Qinghai-Tibet plateau and in other zones of China. Arch Microbiol. 2007;188:103-15.
28. Kim KJ, Yang YJ, Kim JG. Purification and characterization of chitinase from Streptomyces sp. M-20. J Biochem Mol Biol. 2003;36:185-9.
29. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870-4.
30. Leite J, Fischer D, Rouws L, Fernandes Júnior PI, Hofmann A, Kublik S. Cowpea nodules harbor non-rhizobial bacterial communities that are shaped by soil type rather than plant genotype. Front Plant Sci. 2017;7:2064.
31. Madhaiyan M, Poonguzhali S, Lee JS, Saravanan VS, Lee KC, Santhanakrishnan P. Enterobacter arachidis sp. nov., a plant-growth-promoting diazotrophic bacterium isolated from rhizosphere soil of groundnut. Int J Syst Evol Microbiol. 2010;60:1559-64.
32. Markova YA, Romanenko AS, Dukhanina A. Isolation of bacteria of the family Enterobacteriaceae from plant tissues. Microbiology. 2005;74:575-8.
33. Mehnaz S, Mirza MS, Huarat J, Bally R, Normand P, Malik KA. Isolation and 16S rRNA sequence analysis of the beneficial bacteria from the rhizosphere of rice. Can J Microbiol. 2001;47:110-7.
34. Mirza MS, Ahmad W, Latif F, Haurat J, Bally R, Normand P. Isolation, partial characterization, and effect of plant growth promoting bacteria (PGPB) on micro-propagated sugarcane in vitro. Plant Soil. 2001;237:47-54.
35. Morales P, Fernandez-García E, Nunez M. Caseinolysis in cheese by Enterobacteriaceae strains of dairy origin. Lett Appl Microbiol. 2003;37:410-4.
36. Muindi MM, Muthini M, Njeru EM, Maingi J. Symbiotic efficiency and genetic characterization of rhizobia and nonrhizobial endophytes associated with cowpea grown in semi-arid tropics of Kenya. Heliyon. 2021;7:e06867.
37. Muresu R, Polone E, Sulas L, Baldan B, Tondello A, Delogu G. Coexistence of predominantly nonculturable rhizobia with diverse, endophytic bacterial taxa within nodules of wild legumes. FEMS Microbiol Ecol. 2008;63:383-400.
38. Patten C, Glick BR. Bacterial biosynthesis of indole-3acetic acid. Can J Microbiol. 1996;42:207-20.
39. Pikovskaya RI. Mobilization of phosphorus in soil connection with the vital activity of some microbial species. Mikrobiol. 1948;17:362-70.
40. Rahal S, Chekireb D. Diversity of rhizobia and non-rhizobia endophytes isolated from root nodules of Trifolium sp. growing in lead and zinc mine site Guelma, Algeria. Arch Microbiol. 2021;203:3839-49.
41. Ramesh C, Dhar H, Dutt S, Gulati A. A rapid and easy method for the detection of microbial cellulases on agar plates using Gram's iodine. Curr Microbiol. 2008;57:503-7.
42. Ren Y, Ren Y, Zhou Z, Guo X, Li Y, Feng L. Complete genome sequence of Enterobacter cloacae subsp. cloacae type strain ATCC 13047. J Bacteriol. 2010;192:2463-4.
43. Richardson AE, Viccars LA, Watson JM, Gibson AH. Differentiation of Rhizobium strains using the polymerase chain reaction with random and directed primers. Soil Biol Biochem. 1995;27:515-24.
44. Sami AJ, Awais M, Shakoori AR. Preliminary studies on the production of endo-1, 4-β-D glucanases activity produced by Enterobacter cloacae. Afr J Biotechnol. 2008;7:1318-22.
45. Sánchez-Cruz R, Vázquez IT, Batista-García RA, MéndezSantiago EW, Del Rayo Sanchez-Carbente M, Leija AL. Isolation and characterization of endophytes from nodules of Mimosa pudica with biotechnological potential. Microbiol Res. 2019;218:76-86.
46. Schwyn B, Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem. 1987;160:47-56.
47. Tak N, Awasthi E, Bissa G, Meghwal RR, James EK, Sprent JS. Multi locus sequence analysis and symbiotic characterization of novel Ensifer strains nodulating Tephrosia spp. in the Indian Thar Desert. Syst Appl Microbiol. 2016;39:534-545.
48. Tak N, Gehlot HS, Kaushik M, Choudhary S, Tiwari R, Tian R. Genome sequence of Ensifer sp. TW10; A Tephrosia wallichii (Biyani) microsymbiont native to the Indian Thar Desert. Stand Genomic Sci. 2013;9:304-314.
49. Tian F, Ding Y, Zhu H, Yao L, Du B. Genetic diversity of siderophore-producing bacteria of tobacco rhizosphere. Braz J Microbiol. 2009;40:276-284.
50. Torres AR, Araújo WL, Cursino L, Hungria M, Plotegher F, Mostasso FL. Diversity of endophytic Enterobacteria associated with different host plants. J Microbiol. 2008;46:373-379.
51. Tyler HL, Triplett EW. Plants as a habitat for beneficial and/or human pathogenic bacteria. Annu Rev Phytopathol. 2008;46:53-73.
52. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991;173:697-703.
53. Wu LJ, Wang HQ, Wang ET, Chen WX, Tian CF. Genetic diversity of nodulating and non-nodulating rhizobia associated with wild soybean (Glycine soja Sieb. and Zucc.) in different ecoregions of China. FEMS Microbiol Ecol. 2011;76:439-450.
54. Zakhia F, Jederz H, Domerguei O, Willems A, CleyetMareh JC, Gillis M. Diverse bacteria associated with root nodules of spontaneous legumes in Tunisia and first report for nifH-like gene within the genera Microbacterium and Starkeya. Microb Ecol. 2006;51:375-393.
55. Zhao L, Xu Y, Lai X. Antagonistic endophytic bacteria associated with nodules of soybean (Glycine max L.) and plant growth-promoting properties. Braz J Microbiol. 2018;49:269-278.