Genetic polymorphism and hybridity testing in elite soybean parental combinations

Introduction

Soybean (Glycine max L.) often called the "Miracle crop" is an annual dicotyledonous plant belonging to the family Fabaceae (Panzade et al., 2025) [9] . Owing to its exceptionally with high protein content and wide range of application in food, animal feed, and industrial products it's also referred to as functional food and its currently being highlighted for its potential to end malnutrition. (Jadhav et al., 2023) [4] because it comprises protein and oil comprise 60% (40% protein and 20% oil) of the seed with about 30% carbohydrate and other dietary fiber, mineral, vitamins. In 100 g of soybean seeds, the nutritional composition varies among genotypes, with gross energy ranging from 409.82 to 429.98 kcal, crude fat from 17.53 to 23.75 g, calcium from 174.16 to 268.84 mg, iron from 9.84 to 14.30 mg, and phosphorus from 691.73 to 1124 mg (Zewudie et. Al., 2024) [3] . Soybean is one of the world's most important oilseed and protein crops, playing a vital role in meeting the nutritional requirements of the rapidly growing global population. As the demand for food, feed, and industrial raw materials continues to increase, enhancing crop productivity has become a major priority for ensuring global food security. Global soybean production is estimated at 425.7 million metric tonnes (MMT) in 2025, whereas India's production is projected at 10.5 MMT, representing a decline from 12.5 MMT recorded in 2024. This reduction highlights the need for the development of high-yielding, climate-resilient soybean cultivars capable of maintaining stable productivity under diverse environmental conditions. To address these challenges, modern plant breeding strategies increasingly focus on improving yield stability and sustainability. Among these approaches, marker-assisted selection (MAS) has emerged as a powerful and efficient tool that utilizes DNA markers linked to desirable traits, enabling precise and rapid selection of superior genotypes and thereby accelerating crop improvement programs (Shinde et al., 2018) [11] . In addition to improving yield and productivity, enhancing the nutritional and processing quality of soybean has become an important objective in modern breeding programs. Despite its high protein content, the utilization of soybean is constrained by the presence of anti-nutritional factors, particularly the Kunitz trypsin inhibitor (KTI), which interferes with protein digestion. Kunitz trypsin inhibitor (KTI) is a heat-labile, non-glycosylated, monomeric protein of approximately 21-21.5 kDa, consisting of a single polypeptide chain of 181 amino acid residues and containing two disulfide bonds (Liu, 2024; Luo et al., 2025) [7,8] . It inhibits the activity of trypsin, a proteolytic enzyme secreted by the pancreas, thereby reducing protein di gestibility in monogastric animals such as poultry and swine, as well as in young ruminants. Therefore, the development of soybean cultivars lacking KTI has become a major breeding objective. Besides the anti-nutritional effects of Kunitz trypsin inhibitor (KTI), the characteristic beany flavor is another major constraint affecting the acceptability of soybean-based food products. This undesirable flavor results from the oxidation of polyunsaturated fatty acids by lipoxygenase (LOX) enzymes, leading to the formation of volatile compounds such as n-hexanal (Wang et al., 2021). Assessment of genetic variation among parental lines is a prerequisite for successful soybean breeding and hybrid development Several molecular marker systems, including restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), inter-simple sequence repeats (ISSR), and simple sequence repeats (SSR), have been employed for assessing genetic diversity and parental polymorphism in soybean. Among these, SSR markers are particularly useful for soybean genetic diversity analysis because of their polymorphism, reproducibility, and genomewide distribution (Zatybekov et al., 2023; Singh et al., 2024) [16] . Consequently, SSR markers are valuable tools for parental polymorphism analysis, hybrid verification, and marker-assisted soybean breeding.

Materials and Methods

The parental polymorphism survey evaluated four soybean (Glycine max (L.) Merr.) genotypes. Two elite genotypes AMS MB 5-18 and AMS 100-39 characterized by high yield, and resistance to charcoal rot (Macrophomina phaseolina), and elevated seed protein content in AMS 100-39 were procured from Dr. Panjabrao Deshmukh Krishi Vidyapeeth (Dr. PDKV), Akola, and served as the recurrent parents. Two donor parents were utilized: NRC-150, possessing the null alleles for Kunitz trypsin inhibitor (kti) and lipoxygenase-2 (lox2), sourced from the ICAR-Indian Institute of Soybean Research (ICAR-IISR), Indore; and 'Swarna Vasundhara', a bold-seeded vegetabletype genotype, acquired from ICAR-RCER, Ranchi.

Hybridization program

The recurrent parents (AMS MB 5-18 and AMS 100-39) were hybridized with the Donor parents (NRC-150 and Swarna Vasundhara) to develop the F 1 populations. Hybridization program was carried out on staggered sowing plot in Kharif 2025 season.

DNA extraction

The chosen genotypes' young leaves were harvested for the extraction of genomic DNA using the CTAB (Cetyltrimethyl ammonium bromide) technique. The DNA extraction solution (2% CTAB, 100 mM Tris-HCl, 50 mM ethylene diamine tetra acetate (EDTA), and 100 mM NaCl) was applied to crush 15 to 20-day-old soybean leaves. A nanodrop spectrophotometer was used to measure optical density for the quantity and purity of the DNA at 260 and 280 nm and agarose gel electrophoresis was also used to assess the quality of DNA. The dilution of genomic DNA was prepared at 40ng/μL for further experiment.

Source of microsatellite sequences

The primer sequence and SSR sites were retrieved from the soybean database. A total of 220 SSR markers from 20 linkage groups (LG) were used, with an average density of one SSR marker per 5 cM, to assess the level of polymorphism between different parental combinations for background selection. Null allele specific marker (F 5C TTTTGTGCCTTCACCCCT3' and R 5' GAATTCATCATCAGAAACTCTA 3') was used for screening of positive F 1 plants (Hybrids).

SSR profiling of parents

The polymerase chain reaction was performed using 325 primers in an Eppendorf thermal cycler. In a 10 μL reaction mixture with 2.0 μL DNA (20 ng/l), 1.0 μL 10X buffer, 1.1 μL MgCl 2 , 0.1 μL dNTPs (10 mM), 0.4 μL each of forward and reverse SSR primers, 0.068 μL Taq DNA polymerase (5U/ μL), and 4.932 μL nuclease-free water was subjected to PCR amplification. The template DNAs were amplified in a thermo cycler (Applied Bioscience by Thermo Fischer, Waltham, Massachusetts, United states) using the PCR profile: Initial denaturation at 94 °C for 2 minutes. Followed by 32 cycles of denaturation at 94 °C for 1 min, primer annealing at 49 to 52 °C for 2 minutes, and primer elongation at 72 °C for 3 minutes each are then performed. The amplicons' final elongation was allowed to run its course at 72 °C for 10 min before being put on hold at 4 °C. After completion of amplification, PCR products were stored at -20 °C and the amplified products were analyzed by electrophoresis using 8 % Polyacrylamide gel and visualized by EtBr.

Analysis of SSR polymorphism and detection of informative markers

To assess four genotypes, genotyping by SSR marker was scored based on the presence or absence of the bands was used. The data was then organized as discrete variables into a binary matrix, where score '1' denoted the existence of the band and '0' denoted its absence. This data matrix was subsequently subjected to analysis. The polymorphism information content (PIC) for each chromosomal SSR was calculated using the formula to assess the markers' informativeness.

𝑃𝐼𝐶 = 1 -𝑃 𝑖 2

Where Pi is the frequency of the ith plus allele among the group of 4 parental genotypes under investigation, and I is the total number of alleles discovered for the SSR marker. The SSR marker's discriminating power is estimated by the PIC value. The PIC values are divided into three classes: PIC > 0.7 = highly informative, then 0.25> PIC > 0.7= moderate, and PIC < 0.25 = low. Markers with PIC value above 0.5 are informative in genetic studies and are extremely useful in determining polymorphism rate of specific locus [21]. The evaluation of genetic markers is based on DNA bands of PCR amplification results. The polymorphism percentage was also calculated between the parents with the formula illustrated below: 𝑃𝑜𝑙𝑦𝑚𝑜𝑟𝑝ℎ𝑖𝑠𝑚 𝑝𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 = 𝑁𝑜. 𝑜𝑓 𝑃𝑜𝑙𝑦𝑚𝑜𝑟𝑝ℎ𝑖𝑐 𝑚𝑎𝑟𝑘𝑒𝑟𝑠 𝑇𝑜𝑡𝑎𝑙 𝑛𝑜. 𝑜𝑓 𝑚𝑎𝑟𝑘𝑒𝑟𝑠 𝑥100

The polymorphism percentage of markers will be calculated as:

𝑃𝑜𝑙𝑦𝑚𝑜𝑟𝑝ℎ𝑖𝑠𝑚 𝑝𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 𝑜𝑓 𝑚𝑎𝑟𝑘𝑒𝑟 = 𝑁𝑜. 𝑜𝑓 𝑃𝑜𝑙𝑦𝑚𝑜𝑟𝑝ℎ𝑖𝑐 𝑎𝑚𝑝𝑙𝑖𝑐𝑜𝑛𝑠 𝑇𝑜𝑡𝑎𝑙 𝑛𝑜. 𝑜𝑓 𝑎𝑚𝑝𝑙𝑖𝑐𝑜𝑛𝑠 𝑥100

Result and Discussion

In Kharif 2025 season hybridization program was carried out on four elite soybean genotypes. AMS MB 5-18 and AMS 100-39 as recurrent parents and NRC-150 and Swarna Vasundhara as donor parents. Total 301 crosses of 04 cross combinations were attempted. Out of them 32 were successful to developed pod formations (Table .1)

Parental polymorphism survey

To estimate the level of polymorphism in different parental combinations and select SSR markers for background selection, 220 SSR markers spanning 20 linkage groups (LG) were employed. The four parental genotypes were screened with 220 SSR markers among 145 SSR marker were able to produced amplicons (Fig. 1). The PIC value is greater than 0.50% of SSR markers are more informative which will be selected for further breeding programme. Across highly polymorphic SSR markers, two markers i.e. Satt640 and Sat_119 were found polymorphic in all parental combinations with high PIC value > 0.85 and there are located on chromosome 6. In parental polymorphism analysis revealed three classes of microsatel lite repeat motofs, namely di, tri and tetra nucleotide repeats. Among the polymorphic SSR markers tri nucleotide repeats were predomi-nant, followed by di nucleotide 24 and tetra nucleotide 10 across different parental combinations (Table 3, Fig. 3).

Confirmation of hybrid by using null KTI specific primer

The F 1 progenies developed in Kharif 2025 seasons were checked with the help of Null KTI specific marker specified for the null KTI allele from donor NRC150 with 420bp amplicons. Out of 36 plants derived ffrom NRC150 cross combinations 5 plants found to be hybrid with presence of null KTI allele at 420bp (Fig. 3).

Conclusion

The present study identified informative SSR markers for assessing genetic polymorphism among four soybean parental genotypes used in the development of food-grade soybean breeding populations. Among the 220 SSR markers screened, 145 produced clear amplification and 100 were polymorphic, providing a useful set of markers for distinguishing the parental genotypes and supporting background selection. Satt640 and Sat_119 showed polymorphism across all four parental combinations with high PIC values, indicating their potential utility for parental discrimination. In addition, screening with a null KTI-specific marker identified five putative F 1 hybrids carrying the null kti allele among the 36 progenies evaluated from NRC-150-derived crosses. These marker resources can support subsequent generation advancement, selection and molecular characterization of segregating populations aimed at developing soybean lines with reduced KTI content and improved food quality. Further evaluation of the identified progenies through segregation analysis and phenotypic and/or biochemical characterization will be required to confirm the stability and breeding value of the selected material.

Acknowledgement

AcknowledgementThis work was supported by the State Government of Maharashtra under the project "Establishment of Centre of Excellence for Enhancing Crop Productivity under Climate Resilience of Vidarbha Region" (Sanction No. BBA/2023/880; dated 27.06.2023). The authors are grateful to Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola, for providing parental seed materials and field/laboratory facilities at the Biotechnology Centre, Post Graduate Institute. We also sincerely thank Dr. Vineet Kumar, Principal Scientist, ICAR-IISR, Indore, Madhya Pradesh, for kindly supplying the donor seed material.

References

1. Cregan PB, Mudge J, Fickus EW, Marek LF, Danesh D, Denny R, Young ND. Targeted isolation of simple sequence repeat markers through the use of bacterial artificial chromosomes. Theoretical and Applied Genetics. 1999;98(6):919-928.
2. Getaneh Zewudie K, Gemede HF. Assessment of nutritional, antinutritional, antioxidant and functional properties of different soybean varieties: Implications for soy milk development. Cogent Food & Agriculture. 2024;10(1):2380496.
3. Jadhav PV, Shinde AN, Thakur PP, Shinde UD, Mahobia A. Genome-wide microsatellite survey and introgression of null KTI allele in charcoal rot resistant soybean. Journal of Human Nutrition and Food Science. 2023;11(4):1172.
4. Karp A, Seberg OLE, Buiatti M. Molecular techniques in the assessment of botanical diversity. Annals of Botany. 1996;78(2):143-149.
5. by chemical cleavage. European Journal of Biochemistry. 1973;32(3):401-407.
6. International Journal of Agriculture and Nutrition https://www.agriculturejournal.net 26646072, 2026, 8(10), Downloaded from https://www.doi.org/10.33545/26646064.2026.v8.i10a.761 by International Journal of Agriculture and Nutrition on [06/10/2026]. See the Terms and Conditions (https://www.agriculturejournal.net) for rules of use; OA articles are governed by the applicable Creative Commons License
7. Liu K. Enzymatic and algebraic methodology to determine the contents of kunitz and bowman-birk inhibitors and their contributions to total trypsin or chymotrypsin inhibition in soybeans. Journal of Agricultural and Food Chemistry. 2024;72(20):11782.
8. Luo Z, Zhu Y, Xiang H, Wang Z, Jiang Z, Zhao X, Guo Z. Advancements in inactivation of soybean trypsin inhibitors. Foods. 2025;14(6):975.
9. Panzade SA, Chimote VP, Shinde CS, Aher AR. Identification of Soybean (Glycine max L.) Segregants for Kunitz Trypsin Inhibitor and Lipoxygenase Free Gene Using Linked Molecular Markers. Plant Cell Biotechnol. Mol. Biol. 2025;26:33-34.
10. Merr.]. Frontiers in Plant Science. 2025;15:1372037.
11. Shinde UD, Agrawal T, Pradhan A, Kadu T, Kotasthane AS, Verulkar SB. Development of blast resistant Dubraj by introgression of resistant genes through marker assisted selection. International Journal of Current Microbiology and Applied Sciences. 2018;7(6):3113-3118.
12. Shen Y, Jia QL, Liu MZ, Li ZW, Wang LL, Zhao CZ, Li ZX, Zhang M. Genome-wide characterization and phylogenetic and expression analyses of the Caleosin gene family in soybean, common bean, and barrel medic. Archives of Biological Sciences. 2016;68(3):575-585.
13. Wang J, Kuang H, Zhang Z, Yang Y, Yan L, Zhang M, Song S, Guan Y. Generation of seed lipoxygenasefree soybean using CRISPR-Cas9. Crop Journal. 2020;8:432-439.
14. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research. 1990;18:6531-6535.
15. Welsh J, McClelland M. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research. 1990;18:7213-7218.
16. Zatybekov A, Yermagambetova M, Genievskaya Y, Didorenko S, Abugalieva S. Genetic diversity analysis of soybean collection using simple sequence repeat markers. Plants. 2023;12(19):3445. How to cite this article: Thakare N, Jadhav PV, Shinde U, Jadhav B, Parihar M, Mishra C, et al. Genetic polymorphism and hybridity testing in elite soybean parental combinations. International Journal of Agriculture and Nutrition. 2026;8(10):01-06. doi: https://www.doi.org/10.33545/26646064. 2026.v8.i10a.761