Etiopathology of cellulitis in broilers from Nagpur region of central India

Introduction

Cellulitis usually refers to the inflammation of subcutaneous tissue, almost occurring in all the anatomical areas, but most typically observed adjacent to the lower abdomen, breast, thigh and in the regions with loose subcutaneous connective tissue with presence of fibrinonecrotic plaques in broiler chickens (Mellata, 2013) [1] . Cellulitis is important from salubrious point of view, representing its public health issue, but is also relevant in terms of animal welfare (Bianco et al., 2016) [2] . Over the last few decades, cellulitis has emerged as economic important disease of broilers and turkeys (Lighty et al., 2015). Cellulitis may be a secondary finding in a number of conditions. Escherichia coli is the predominant microorganism isolated from cellulitis although other agents, such as Pasteurella multocida, Pseudomonas aeruginosa, Enterobacter agglomerans, Proteus vulgaris and Streptococcus dysgalactiae have also been isolated from cellulitis lesion (Norton et al., 2000; Gomis et al., 2000) [4,3] . During, finisher stage of growth in broilers the development of disease is accompanied by interrupting the integrity of the skin, such as a traumatic wound or other cutaneous abrasion enabling a variety of bacteria to enter the wound and colonize the subcutaneous tissue (Quel et al., 2013) [5] . Nutritional deficiency, contamination of water resources and Litter-moisture appears critical to cellulitis development (Hilmy et al., 2002, Mellata et al., 2013) [1] . With the advancement of molecular biological techniques, Enterobacterial repetitive intergenic consensuspolymerase chain reaction (ERIC-PCR) methods could resolve the genotypes of the large number of antigen serotypes, thereby enabling identification of an appropriate immunogenic strain (Guay, 2009; Flores et al., 2009; Indrawattana et al., 2011) [7,6,8] . Further, would be useful in determining the sequence distribution and copy numbers of chromosomes for ERICs for showing the interspecies specificity (Lang et al., 2013) [9] . Considering the importance of avian cellulitis in the context of poultry meat production, present study was aimed at performing microbiological isolation, detecting antimicrobial resistance genes in microorganisms and to establish an ERIC-PCR method for genotyping of E. coli strains in poultry cellulitis with other non-cellulitis E. coli cases of poultry, buffalo, cow, dog in and around Nagpur region of Central India,

Material and methods

Selection of birds with cellulitis: Total 9 broiler rearing farms around Nagpur were visited as they had problem of lingering mortality in the finisher stage of broiler production from November 2017 to June 2018. During visit the 28 broiler carcasses, which grossly showed the caudal abdominal discoloration and thickening of skin after feather removal, were collected prior to evisceration and examined for cellulitis, 28 birds from 9 flocks were sampled across Nagpur region and detailed post mortem examination was conducted at Department of Veterinary Pathology, Nagpur, India. Cellulitis lesions were characterized grossly by yellowish fibrin deposit underneath this discolored or thickened skin. Swabs from cellulitis lesions and any other gross lesions observed in the body cavity were propagated in nutrient broth and incubated overnight at 37°C followed by aseptically culture on BHI Agar and selective media that is Eosin Methylene Blue (EMB) Agar (Himedia, Mumbai) specially used for E. coli isolation. All the inoculated media were incubated at 37°C and inspected for growth for 24 hours. Then the Gram's staining was performed on the smear prepared from isolated colony. Gram negative isolates were subjected for molecular and phenotypic characterization along with Antibiotic Sensitivity Test (AST).

Histopathology

After complete examination of the carcass the skin sections from the affected areas (including the site where bacteria were lodged) like heart and liver were preserved in 10% buffered formalin, were processed, later embedded in paraffin and further sections were cut using a microtome. The sections were stained by the haematoxylin and eosin (HE) method and were examined under light microscopy. Antibiotic susceptibility: The recovered E. coli isolates (26) were subjected to antibiotic sensitivity testing using disc diffusion method (Barbieri et al. 2013). The antibiotic discs were obtained from Himedia Laboratories Pvt. Ltd., Mumbai, India. The isolates were tested against commonly used antibiotics Enrofoxacin (10 mcg), Ciprofloxacin (5 mcg), Chlortetracycline (30 mcg), Furazolidone (100 mcg), Levafloxacin (5 mcg), Doxycycline (30 mcg), Oxytetracycline (30 mcg), Neomycin (30 mcg), Chloramphenicol (30 mcg), Bacitracin (10 units), Cephalaxin (30 mcg) and Colistin sulphate (10 mcg) and interpretations of zone diameters were done by the Quality Control Limits for Antibiotics based on results obtained by Muller Hinton Agar (Himedia, Mumbai). MALDI-TOF MS analysis for the evaluation of the mass: Single bacterial colony of each isolates were picked up from primary culture and re-streaked on fresh Brain Heart Infusion (BHI) agar and incubated at 37 ℃ for 24hrs to obtain pure colony of culture of the isolates. The organism was characterized by biochemical reactions using Biomerieux Vitek® 2 System and future identified by Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS, Biomeriex, Marcy 1'Etoile France) as per the method recommended by Barberis et al. (2014) [10] DNA extraction and PCR: Genomic DNA isolation was performed by using Himedia DNA isolation Kit. PCR was performed by using Gradient Master Cycler (Eppendorf, India) to determine the presence of virulence marker genes of avian pathogenic E. coli in bacteria for cvi and tsh genes. The following primer sequences: for tsh gene Forward primer-5' ACTATTCTCTGCAGGAAGTC 3' and Reverse-5' CTTCCGATGTTCTGAACGT 3' while for cvi gene Forward-5' TGGTAGAATGTGCCAGAGCAAG 3' and Reverse-5' GAGCTGTTTGTAGCGAAGCC 3' were used for amplification (Ewers et al., 2004). The PCR reaction were carried out as given protocol: Nuclease free water (9.5 µl), GoTaq® Green Master Mix 2X (12.5 µl), Forward primer 20pmol (1.0 µl), Reverse primer 20pmol (1.0 µl), Template DNA (1.0 µl) with the total of 25 µl. The cycling conditions in Master gradient cycler for tsh and cvi genes were initial denaturation at 94°C for 3 mins, 30 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec (tsh) and 68°C 3 min (cvi) respectively and extension at 72°C for 10 min, then hold it at 4°C. Finally the amplified PCR product was loaded in agarose gel (1.5% agarose in 0.5X Tris borate-EDTA buffer, ethidium bromide (0.5 µg/ml) along with standard molecular size marker (100 bp DNA ladder). The gel was electrophoresed (Horizontal gel electrophoresis system, Genaxy). Amplified product were separated on agarose gel and observed by ultraviolet transiluminator and photographed in a gel documentation system (Syngene, USA). Genotyping by ERIC-PCR: Strains were characterized by PCR using ERIC primers (Ranjba et al. 2017) [11] . Two primers with sequence ERIC (F) 5'ATGTAAGCTCCTGGGGATTCAC 3' and ERIC (R) 5'AAGTAAGTACTGGGGTGAGCG 3'were used to amplify repetitive sequence contained in the chromosomal DNA of E. coli isolates. ERIC PCR was carried with 25μl of the PCR mixture comprised of 100ng of E. coli DNA, 1μl (10pmol) of each ERIC-F,' and ERIC-R', GoTaq® Green Master Mix 12.5μl and 9.5μl of Nuclease free water. The cycling conditions in Master gradient cycler for ERIC primers were initial denaturation at 95⁰C for 7 min, 35 cycles of denaturation at 95⁰C for 1min; annealing at 56⁰C for 1min; extension at 72⁰C for 90 sec and final extension at 72⁰C for 7 min, then hold it at 4⁰C. The amplicons were electrophoresed on 1.5% agarose gel, along with 100 bp DNA ladder, and the 6X gel, loading dye containing 0.5 mg/mL of ethidium bromide was added. The image was captured by using gel documentation system (Syngene, USA).

Results

Broiler birds suspected for cellulitis showed brownish-red discolouration of skin around the inflamed area (Fig. 1). On opening the carcass, petechial hemorrhages localised to tip of sternum and abdominal wall were observed along with yellowish semisolid masses on inner aspect of thigh muscle, wings, breast, keel bone area, back and flank region (Fig. 2). Thickening of the diseased skins was self-evident finding. Yellowish plaques were observed in the subcutaneous tissues. In addition to cellulitis, the birds had pericarditis, airsacculitis, perihepatitis (Fig. 3), polyserositis (a combination of pericarditis, perihepatitis and airsacculitis (Fig. 4), usually birds with such combination appeared emaciated and with poor musculature. Microscopic examination revealed necrosis of muscular layer attached to skin (Fig. 5), along with fibrinocaseous exudates and inflammatory cells in between muscles fibers (Fig. 6). The muscle layer was submerged by fibrinous exudate mixed with inflammatory cells and bacteria (Fig. 7). Subcutaneous fascia revealed congestion and infiltration of inflammatory cells heterophils and mononuclear cells in between adipocytes (Fig. 8). Mild hyperkeratosis and hyperplasia of epidermal epithelial cells, vasculitis overloaded with accumulation of inflammatory cells was evident (Fig. 9). Swab samples from 28 broiler carcasses were taken for isolation and identification of bacteria at the time of post mortem. Twenty six cases showed bacterial growth. While, no bacteria were isolated from cellulitis lesions of 2 birds. Metallic sheen on EMB agar plate was seen in 26 cases. The results of Biomerieux Vitek® 2 System and MALDI-TOF MS revealed that all 26 cases harboured E. coli, out of which in 19 cases (67.85 %) E. coli was the only bacterial species found. In one case (3.57%) E. coli and Staphylococcus xylosus was present. In one case (3.57%) E. coli and Staphylococcus saprophyticus was isolated. Additionally, E. coli along with Enterococcus cecorum and Enterococcus faecium were observed in 5 (17.85%) cases. Antibiotic sensitivity results of isolated E. coli is presented in Table .1. All isolates showed 100% resistant towards Enrofoxacin, Ciprofloxacin, Furazolidone, Levafloxacin, Oxytetracycline and Bacitracin. While 60-70% resistance by Chlortetracycline, Doxycycline, Neomycin, Chloramphenicol, Cephalaxin and 15.38% least resistance was observed by Colistin sulphate. Confirmed 26 isolates of E. coli (by MALDI-TOF) were future investigated for presence of virulence associated genes i.e., cvi and tsh gene, which are associated with cellulitis. It was observed that 16 iso-lates were positive for both cvi and tsh genes, while 8 isolates were positive for only tsh genes, and only 2 isolates were positive for cvi gene alone (Fig 10). The ERIC-PCR generated distinct amplification products that were differentiated by agarose gel electrophoresis (Fig. 11). Amplicons of 26 isolates produced 1-7 bands ranged between 100 ˃ 3,000 bp (Fig. 12). Cluster analysis of E. coli strains showed that they were classified into 6 major groups. The generated banding profile showed highly polymorphic DNA fragments in all these isolates.

Discussion

Owing to the importance of cellulitis in broiler industry various attempts have been made worldwide to know the prevalence of cellulitis in broiler chickens ( [3,12,2] . The reports of avian cellulitis from Indian subcontinents is missing so the study was undertaken to know causes of cellulitis in broiler chickens, for the first time across Nagpur region in Central, India. As reported worldwide, we also report the cases of cellulitis in broilers from central India. The cellulitis associated lesions were present on inner aspect of thigh muscle, wings, breast, keel bone area, back and flank region. The development of this infection is asso-ciated with skin surface injuries, often caused by close contact among birds and litter quality (Xavier et al., 2010, Mellata 2013) [12] . We report that cellulitis is often accompanied by septicaemia-toxaemia i.e., pericarditis, airsacculitis, perihepatitis, polyserositis. These lesions leads to the slowed processing lines, carcass down grading and total financial losses due to condemnation of carcasses (Norton et al., 2000) [4] . Microscopically severe hyperkeratosis and thickening of the dermis along with evidence of infiltration of mononuclear cells and heterophils as observed occur due to weak innate immune response of the broilers (Olkowski et al., 2005, Mellata 2013) [13] . The lesions further worsen to necrotic cellular debris and fibrinocaseous exudates due to growth of bacteria (Bianco et al., 2016) [2] .

The main cause for broiler chicken cellulitis in Nagpur region seems to be E. coli which was confirmed by observing metallic sheen on EMB agar and MALDI-TOF result. In 26.92 percent cases it was also complicated with other bacterial pathogens. Earlier Norton et al., (2000) [4] , Fallavena et al., (2000) [14] , Johnson et al., (2001) [15] also claimed that E. coli is the major pathogen which causes avian cellulitis. The prevalence of cellulitis with other systemic manifestations of E. coli in broilers has been reported earlier by Gomis et al., (2000) [3] . All the E. coli isolates harbors both or either of pathogenic cvi and tsh genes. The role of cvi and tsh genes in the virulence profiling of Avian Pathogenic E. coli has been intiated by Ewers et al., (2004) later on confirmed by Kemmett et al., (2014) [16] . These genes are usually absent in the non chicken source of E. coli. The ERIC-PCR method is recently being used as molecular epidemiological tool and analyses different bacteria (Ahmed et al., 2012) [17] . This technique is used mostly to know the source of the isolate and to know the genetic homology of the isolates. We used the ERIC-PCR typing technique to analyze the source of pathogenic APEC in all isolates along with E. coli isolated from dogs, cow, and buffalo. The pat-tern of bands observed by ERIC PCR was different in chicken isolates as compared to E. coli from other animal species. The present results indicates that APEC present in the chicken environment or one infected chicken is source of infection to the broilers and exhibit cellulitis and responsible for economic losses. In this present study we report the cases of avian cellulitis from central India, majorly caused by E. coli. These isolates were sensitive towards Colistin sulphate and resistant towards Enrofoxacin, Ciprofloxacin, Furazolidone, Levafloxacin, Oxytetracycline and Bacitracin. These E. coli harbors pathogenic genes cvi and tsh. These isolates has distinct different pattern of ERIC PCR and can be well differentiated from E. coli of other species.

Methodology

Acknowledgement

AcknowledgementsAuthors are thankful to Associate Dean, Nagpur Veterinary College, MAFSU, Nagpur, Maharashtra for providing necessary help and facilities for the successful completion of this work.

References

1. Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne pathogens and disease. 2013;10(11):916932.
2. Bianco C, Balanescu B, Cieslicka U, Balanescu P, Stefanov K, Lopez P, Hristova N, House C, Way C, Park T, Bianco C, House C. The Shades of Avian Cellulitis in Meat-Type Chicken Chain of Infection. Research & Reviews: Journal of Veterinary Sciences. 2016;2:49-52.
3. Gomis SM, Gomis AIU, Horadagoda NU, Wijewardene TG, Allan BJ, Potter AA. Studies on cellulitis and other disease syndromes caused by Escherichia coli in broilers in Sri Lanka. Tropical animal health and production. 2000;32(6):341-351.
4. Norton RA, Macklin KS, McMurtrey BL. The association of various isolates of Escherichia coli from the United States with induced cellulitis and colibacillosis in young broiler chickens. Avian Pathology. 2000;29(6):571-574.
5. Quel NG, Aragão AZB, Salvadori MR, Farias AS, Joazeiro PP, Santos LMB, Sá LRMD, Ferreira AJP, Yano T. Cellulitis lesions in broiler chickens are induced by Escherichia coli vacuolating factor (ECVF). Veterinary microbiology. 2013;162(2-4):866-872.
6. Flores J, Okhuysen PC. Enteroaggregative Escherichia coli infection. Current opinion in gastroenterology. 2009;25(1):8-11.
7. Guay DR. Cranberry and urinary tract infections. Drugs. 2009;69(7):775-807.
8. Indrawattana N, Nibaddhasobon T, Sookrung N, Chongsa-nguan M, Tungtrongchitr A, Makino SI, Tungyong W, Chaicumpa W. Prevalence of Listeria monocytogenes in raw meats marketed in Bangkok and characterization of the isolates by phenotypic and molecular methods. Journal of health, population, and nutrition. 2011;29(1):26.
9. Lang XY, Zhang YL, Jiang HT, Jiao LIU, Hong-Bo NI. Development of an enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) to detect and genotype enterotoxigenic Escherichia coli of calf origin. African Journal of Microbiology Research. 2013;7(31):4001-4005.
10. Barberis C, Almuzara M, Join-Lambert O, Ramírez MS, Famiglietti A, Vay C. Comparison of the Bruker MALDI-TOF mass spectrometry system and conventional phenotypic methods for identification of Gram-positive rods. PLoS One. 2014;9(9):e106303.
11. Ranjbar R, Tabatabaee A, Behzadi P, Kheiri R. Enterobacterial repetitive intergenic consensus polymerase chain reaction (ERICPCR) genotyping of escherichia coli strains isolated from different animal stool specimens. Iranian journal of pathology. 2017;12(1):25.
12. Xavier DB, Broom DM, McManus CMP, Torres C, Bernal FEM. Number of flocks on the same litter and carcase condemnations due to cellulitis, arthritis and contact foot-pad dermatitis in broilers. British Poultry Science. 2010;51(5):586-591.
13. Olkowski AA, Wojnarowicz C, Chirino-Trejo M, Wurtz BM, Kumor L. The role of first line of defence mechanisms in the pathogenesis of cellulitis in broiler chickens: skin structural, physiological and cellular response factors. Journal of Veterinary Medicine Series A. 2005;52(10):517-524.
14. Fallavena LC, Moraes HL, Salle CT, Da Silva AB, Vargas RS, Do Nascimento VP, Canal CW. Diagnosis of skin lesions in condemned or downgraded broiler carcasses-a microscopic and macroscopic study. Avian Pathology. 2000;29(6):557-562.
15. Johnson LC, Bilgili SF, Hoerr FJ, McMurtrey BL, Norton RA. The effects of early exposure of cellulitis-associated Escherichia coli in 1-day-old broiler chickens. Avian Pathology. 2001;30(2):175-178.
16. Kemmett K, Williams NJ, Chaloner G, Humphrey S, Wigley P, Humphrey T. The contribution of systemic Escherichia coli infection to the early mortalities of commercial broiler chickens. Avian Pathology. 2014;43(1):37-42.
17. Ahmed MU, Dunn L, Ivanova EP. Evaluation of current molecular approaches for genotyping of Campylobacter jejuni strains. Foodborne pathogens and disease. 2012;9(5):375-385.
18. Osman J. Bacteria Associated With Avian Cellulitis In Broiler Chickens. M. Sc Thesis, Microbiology, Faculty of Vet. Med. University of Khartoum; 2002.
19. Lighty ME, Elvinger F, Evans RD, Sriranganathan N, LeRoith T, Pierson FW. Incidence of clostridial dermatitis (cellulitis) and factors for development of the disease in turkeys. Journal of Applied Poultry Research. 2016;25(1):104-112.
20. Norton RA. Avian cellulitis. World's Poultry Science Journal. 1997;53(4):337-349.
21. How to cite this article: Thorat S, Sonkusale P, Kurkure N. Etiopathology of cellulitis in broilers from Nagpur region of central India. International Journal of Advanced Biochemistry Research. 2026;10(9):590-599. doi: https://www.doi.org/10.3354