Incidence of Babesia gibsoni in dogs in and around Shivamogga

Introduction

Canine babesiosis is a tick-borne hemoprotozoan disease caused by intraerythrocytic parasites of the genus Babesia, belonging to the phylum Apicomplexa. Among the various species, Babesia gibsoni is the predominant causative agent of canine babesiosis in India, with prevalence rates ranging from 6% to 64% depending on geographic location and diagnostic method employed (Kumar et al., 2015; Mahalingaiah et al., 2017) [8] . The disease is transmitted primarily by Rhipicephalus sanguineus and Dermacentor species tick and presents with a wide spectrum of clinical signs including anemia, thrombocytopenia, fever, lethargy, splenomegaly and multi-organ dysfunction (Mittal et al., 2019; Prerna et al., 2021) [9] .

Materials and Methods

A total of 58 samples were collected from dogs with a history of tick infestation and exhibiting clinical signs of high fever, pale / icteric mucous membrane, inappetence, anaemia, lethargy, vomiting, diarrhoea, hemoglobinuria from different breeds, gender and age group of dogs during the period from January 2025 to June 2025, which were presented to Veterinary clinical practice Shivamogga. Blood samples were collected in vacutainer containing EDTA as anticoagulant and stored at -20 °C for further processing. Blood samples were screened by PCR.

Polymerase Chain Reaction (PCR)

The extraction of genomic DNA from whole blood was done by using HiPurA® Blood Genomic DNA Miniprep Purification Kit (Himedia, HiGenoMB® Catalogue no. MB504) as per the manufacturer's protocol. DNA samples were amplified using Babesia and B. gibsoni species specific primers (Hilpert Hauser et al., 2007, Jain et al., 2018) [4,6] .

The specific amplicon size of 440 bp and 488 bp was analysed by 1.2% agarose ethidium bromide gel electrophoresis.

Primers:

The primers for Babesia genus and Babesia gibsoni were procured from procured from Bio serve biotechnologies India Pvt. Ltd., Hyderabad. [4] 2 18S rRNA BAGI F: TTGGCGGCGTTTATTAGTTC BAGI R: AAAGGGGAAAACCCCAAAAG 488bp Jain et al. (2018) [6] F: Forward Primer and R: Reverse Primer

Results

A total of 58 dogs suspected for canine babesiosis of which 18 dogs were positive for babesiosis by PCR were studied and are documented in Table 5. Out of 18 dogs, examined, the most evident clinical signs reported were fever and anorexia (94.44%), followed by tick infestation (83.33%), depression and lethargy (66.66%), pale conjunctival mucous membranes (55.55%), respiratory distress and vomiting (50.00%), lymphadenopathy and weakness were (38.88%), ascites, jaundice, dark urine and icteric oral mucous membranes (22.22%) and the least frequently noted clinical signs were melena (16.66%), papery white conjunctival mucous membranes and petechial hemorrhages (5.55%) were present (Table 5). 7). Among 18 PCR-positive cases of canine babesiosis, male dogs showed a higher occurrence (61.11%) compared to female dogs (38.88%) (Table 8).

Discussion

In the present study, the most common clinical signs in Babesia gibsoni infected dogs were fever and anorexia, followed by tick infestation, depression, lethargy, pale mucous membranes, respiratory distress and vomiting, which aligns with earlier reports by Furlanello et al. (2005) [1] , Nandini et al. (2016) [10] , Sindhu et al. (2020), Preena et al.

(2021) [12] , Soundarya et al. (2023) [15] and Patel et al. (2023) [11] . These signs are largely attributed to erythrolysis, inflammatory mediator release, anemia, hypoxia and liver dysfunction as described by Wadhwa et al. (2011) [16] , Yogeshpriya et al. (2014) and Gonmei et al. (2020) [3] . Less frequent findings, such as icterus, ascites, melena and petechial hemorrhages, reflect hemolysis, reduced platelet count and impaired bilirubin clearance (Preena et al., 2021) [12] . The variability in clinical presentation supports the influence of disease stage, immune response and multisystemic involvement.

A significant increase in rectal temperature, heart rate and respiratory rate was observed in affected dogs, likely due to cytokine release and compensatory responses to anemia and hypoxia (Wadhwa et al., 2011) [16] . These findings are consistent with Islam et al. (2017) [5] , Roopali et al. (2018), Gonmei et al. (2020) [3] and Patel et al. (2023) [11] , who also reported elevated physiological parameters in B. gibsoniinfected dogs compared to healthy controls.

Breed-wise Prevalence

In the present study, Labrador Retrievers showed the highest prevalence of Babesia gibsoni infection (44.44%), followed by non-descript dogs (27.77%), Golden Retrievers (11.11%), and German Shepherds, Mudhol Hounds, and Siberian Huskies (5.55% each). This pattern aligns with earlier reports by Mahalingaiah et al. (2017) [8] , Gonde et al. (2017) and Shinde et al. (2021) [14] , who also noted Labradors as the most commonly affected breed. Although some studies such as Kunwar et al. (2021) [7] and Ranatunga et al. (2022) [13] reported higher susceptibility in German Shepherds, these differences likely reflect regional breed popularity, tick exposure and variations in dog populations. Overall, findings suggest a possible breed predisposition, with Labradors appearing more susceptible in the studied region.

Age-wise Prevalence

Babesiosis was most common in dogs aged 1-3 years (50%), followed by 3-6 years (22.22%), with much lower occurrence in dogs below 1 year and 6-9 years (11.11%) and the least in 9-12 years (5.55%). Similar age-related susceptibility was reported by Mahalingaiah et al. (2017) [8] and Shinde et al.

(2021) [14] , likely due to higher outdoor activity and tick exposure in young adults. Some studies, however, noted higher prevalence in older dogs, possibly due to long-term tick exposure. Overall, young adult dogs remain the most vulnerable age group.

Sex-wise Prevalence

Male dogs showed a higher prevalence of babesiosis (61.11%) compared to females (38.88%), similar to reports by Mahalingaiah et al. (2017) [8] , Shinde et al. (2021) [14] and others, likely due to greater outdoor exposure and roaming behavior. However, some studies observed no major sex difference, suggesting that management and exposure factors may influence the pattern

Conclusion

The study confirms Babesia gibsoni as a significant cause of canine babesiosis, with fever, anorexia and tick infestation being the predominant clinical signs. PCR proved effective in detecting infection, identifying 18 positive cases. Labrador Retrievers, young adult dogs (1-3 years) and males were more frequently affected, suggesting possible breed, age and sex related susceptibility, likely influenced by outdoor activity and tick exposure. These findings highlight the importance of early diagnosis, tick control and targeted preventive strategies for high-risk groups.

References

1. Anju S, Vijayakumar K, Sulficar S, Shyma VH, Deepa PM. Haematobiochemical changes associated with Babesia gibsoni infection in dogs. J Vet Anim Sci. 2022;53(1):22-26.
2. Furlanello T, Fiorio F, Caldin M, Lubas G, SolanoGallego L. Clinicopathological findings in naturally occurring cases of babesiosis caused by large form Babesia from dogs of northeastern Italy. Vet Parasitol. 2005;134(1-2):77-85.
3. Gonmei C, Sarma K, Roychoudhury P, Ali MA, Singh D, Prasad H, et al. Molecular diagnosis and clinicohaematobiochemical alterations and oxidant-antioxidant biomarkers in Babesia-infected dogs of Mizoram, India. J Vector Borne Dis. 2020;57(3):226-233.
4. Hilpert Hauser H, Deplazes P, Meli ML, HofmannLehmann R, Lutz H, Mathis A. Genotyping of Babesia bigemina from cattle from a non-endemic area (Switzerland). Vet Parasitol. 2007;145(1-2):59-64.
5. Islam ST, Ganaei MY, Singh AK, Gupta T, Sharma S, Noor S. Ehrlichiosis in a Labrador dog: a case study. J Pharmacogn Phytochem. 2017;6(11):690-692.
6. Jain KJ, Lakshmanan B, Syamala K, Praveena JE, Aravindakshan T. High prevalence of small Babesia species in canines of Kerala, South India. Vet World. 2017;10(11):1319-1323.
7. Kunwar V, Bhatt P, Kumar S, Yadav M, Singh AK. Epidemiological investigation on canine babesiosis in Tarai region of Uttarakhand. Indian J Anim Sci. 2021;91(5):368-371.
8. Mahalingaiah MK, Ananda KJ, Kavitha Rani B. Clinical and molecular detection of Babesia gibsoni in canines. Int J Curr Microbiol App Sci. 2017;6(9):1731-1737.
9. Mittal M, Chakravarti S, Sharma AK, Chander V, Shivkumar M, Santhosh S. Diagnosis of canine babesiosis: an overview. J Parasit Dis. 2019;43(4):541553.
10. Nandini MK, Vishwakarma P, Kamran CA. New therapeutic protocol for canine babesiosis: a case report. J Dairy Vet Anim Res. 2016;3(3):112-113.
11. Patel AR, Patel MD, Mehta SA, Parmar SM, Mavadiya SV, Vala JA, et al. Comparative efficacy of two antibabesial treatment protocols against canine babesiosis in and around Navsari, Gujarat. Pharma Innov J. 2023;12(10):1705-1711.
12. Preena P, Sarangom SB, Ramesh Kumar KV, Seeja S, Rajalakshmi S. Haematological alterations in large Babesia species infection in dogs of Kannur District of Kerala. J Parasit Dis. 2021;45(4):1090-1095.
13. Ranatunga RAS, Dangolla A, Sooriyapathirana SDSS, Rajakaruna RS. High asymptomatic cases of babesiosis in dogs and comparison of diagnostic performance of conventional PCR vs blood smears. Acta Parasitol. 2022;67(3):1217-1223.
14. Shinde SS, Ambore BN, Pawar PD, Swami SB, Wankhede GD, Mote CS. Diagnosis of Babesia gibsoni in dogs by molecular and microscopy techniques. Int J Curr Microbiol App Sci. 2021;10(2):2285-2290.
15. Soundarya TC, Anil Kumar MC, Kshama MA, Pavitra BH, Shivaraj M, Anjan KR. Incidence of Babesia gibsoni in dogs in and around Bengaluru. Pharma Innov J. 2023;12(10):2572-2575.
16. Wadhwa DR, Pal BK, Mandial RK, Adarsh K, Agnihotri RK. Clinical, haematobiochemical and therapeutic studies on canine babesiosis in Kangra Valley of Himachal Pradesh. J Vet Parasitol. 2011;25(1):39-41.