Isolation and molecular identification of klebsiella spp. from poultry and agricultural settings: A morphological and genotypic approach

Introduction

Klebsiella species, is a Gram-negative, non-motile, encapsulated bacteria that are commonly found as commensals in the gastrointestinal tract of poultry and other animals. In healthy birds, these bacteria generally coexist harmlessly within the gut microbiota, playing no apparent pathogenic role. However, under certain conditions such as stress, immunosuppression, or disruption of the normal microbiota Klebsiella can become an opportunistic pathogen. In poultry, this may lead to respiratory infections, septicemia, or localized infections such as yolk sac infections in chicks. Moreover, Klebsiella spp. isolated from poultry environments have increasingly shown resistance to multiple classes of antibiotics, including β-lactams and fluoroquinolones, raising significant concerns about their role as reservoirs of antimicrobial resistance (AMR). Although the prevalence of Klebsiella in poultry is relatively low compared to other pathogens, its capacity to acquire and disseminate resistance genes underscores the importance of routine monitoring and molecular surveillance in poultry production systems to mitigate potential zoonotic transmission and safeguard both animal and public health. Among the most concerning pathogens linked to antibiotic resistance is the ESKAPE group a collection of clinically significant bacteria. This group includes Klebsiella pneumoniae, Acinetobacter baumannii, Staphylococcus aureus, Enterococcus faecium, Pseudomonas aeruginosa, and Enterobacter species, all of which are major contributors to hospital-acquired infections and are increasingly resistant to multiple drug classes. Klebsiella pneumoniae is particularly concerning due to its role in severe infections, especially in immunocompromised and critically ill patients, and its increasing resistance to antibiotics. It also poses significant risks in animal populations, particularly poultry (Singh 2018; Kot B, Witeska, 2024) [1,2] . Global antibiotic consumption in animals is estimated to be twice that of humans. The improper and excessive use of these drugs in veterinary practices both for therapeutic purposes and as growth promoters has played a major role in the emergence of multidrugresistant (MDR) microorganisms. This concern is especially pronounced in modern intensive poultry farming systems, where high-density bird populations kept in confined spaces create ideal conditions for the rapid spread of antibiotic-resistant bacteria (Chaudhry et al., 2020) [3] .

In poultry, Klebsiella species are commonly found in the intestinal flora, but they can become opportunistic pathogens when the birds' immune systems are weakened. K. pneumoniae has been isolated from birds with respiratory infections, where it exacerbates symptoms such as gasping, sinus swelling, and respiratory inflammation. The spread of Klebsiella within poultry populations can lead to significant economic losses, due to cost of treatment or culling. Considering the significance of Klebsiella in poultry and the limited research on this pathogen in the Madhya Pradesh region, this study was undertaken to identify and confirm Klebsiella in poultry and farm environmental samples. The investigation utilized both phenotypic and genotypic methods, employing published primers to ensure precise detection and characterization.

Materials and Methods

The study aimed to isolate Klebsiella species from poultry and the farm environment. A total of 150 samples were collected from various poultry farms around Mhow and Indore. The samples included nasal exudate, cloacal swabs, feed, water and litter as given in Table 01. The samples were streaked on MacConkey agar and bacterial isolates were identified as Klebsiella based on their cultural, morphological, and biochemical characteristics like Gram staining and catalase, oxidase, IMViC and urease tests. Genotypic confirmation of isolates was done by PCR using primers targeting the genusspecific gyrA gene for genus Klebsiella and the species-specific gene

Phenotypic Isolation of Klebsiella Isolation of Klebsiella:

After collection, samples were transported on ice to the lab, inoculated into BHI broth, and incubated at 37 °C for 12 hours for enrichment. A loopful of growth from BHI was streaked onto MacConkey agar and incubated at 37 °C for 24-48 hours. Mucoid pink colonies, indicating lactose fermentation, were transferred to EMB agar to exclude E. coli. Colonies that fermented lactose but lacked a metallic green sheen on EMB were Gram-stained. Gram-negative rods were selected for further bacterial identification.

Identification of Klebsiella:

Klebsiella identification was initially based on colony and bacterial morphology. Biochemical tests were then performed according to the procedure described by Barrow and Feltham (1993) [4] .

Gram staining

For Gram staining, a single bacterial colony was picked, smeared on a glass slide, and fixed by gentle heating. Crystal violet was applied for 2 minutes, followed by washing with running water. Lugol's iodine was added for 1 minute, and then washed off. Acetone alcohol was briefly applied, and after washing, safranine was added for 1 minute. The slide was washed, blotted, air-dried, and examined under a 100X oil immersion lens.

Capsular staining

A single bacterial colony was stained using the negative staining method to reveal the capsule. A drop of nigrosin was placed on one end of a clean slide, and a loopful of inoculum was mixed in the stain. A thin smear was made by spreading the culture at a 45° angle, air-dried, and examined under a 100X oil immersion lens.

Motility examination

A loopful of 6-8 hour old BHI broth culture was placed in the depression of a concavity slide, and a coverslip was added, sealing the edges with paraffin. The slide was examined under a 40X high-power objective lens.

Catalase test

A loopful of 24-hour old culture from a nutrient agar slant was mixed with 3% hydrogen peroxide on a clean slide. A catalasepositive strain exhibited immediate effervescence.

Oxidase test

A loopful of bacterial growth was rubbed on a moistened oxidase disc. A deep purple or mauve color within 10 seconds indicated a positive reaction, while no color change was considered negative.

Triple sugar iron test (TSI)

A well-isolated colony was inoculated into Triple Sugar Iron agar by stabbing the medium and streaking the slant. The slants were incubated at 35 °C for 18-24 hours. A positive reaction was indicated by gas formation, yellowing of both the slant and butt (acidic reaction), while no change signified a negative result.

Methyl Red test (MR)

A loopful of test culture was inoculated into 2 ml sterile glucose phosphate broth and incubated at 37 °C for 48 hours. After incubation, 2 drops of methyl red were added. A positive reaction was indicated by a pink-red color, while a negative reaction showed yellow.

Voges -Proskauer test (VP)

After the methyl red test, the same cultures were used for the Voges-Proskauer (V.P.) test. Two drops of creatine solution and 1 ml of 40% potassium hydroxide were added, and the tubes were gently shaken and kept at room temperature in a slanting position for up to 4 hours. A positive reaction was indicated by eosin-pink color development, while no color change indicated a negative result.

Indole test

A loopful of bacterial culture was inoculated into the medium and incubated at 37 °C for 48 hours. Afterward, 0.5 ml of Kovac's Indole reagent was added and shaken gently. A red color ring indicated a positive reaction, while a yellow ring indicated a negative reaction.

Citrate utilization test

The organisms were grown aerobically on Simmon's citrate agar slopes at 37 °C for up to 7 days. A positive reaction was indicated by the development of a blue color, while no color change was negative. Positive tubes were subcultured onto another slant and reincubated at 37 °C for 7 days; redevelopment of blue confirmed the positive result.

Urease test

The cultures were heavily inoculated into Christensen's urea broth and incubated at 37 °C for 24-48 hours. The tubes were observed after 4 hours and up to 4 days. A negative result showed no color change or yellow, while a positive result displayed a purple-pink color.

Glucose utilization test

Peptone water with glucose was inoculated and examined daily for 7 days. A positive reaction was indicated by a yellow color, while a negative reaction showed an orangered color.

Genotypic detection of Klebsiella isolates

Klebsiella isolates, thus identified by phenotypic methods, were further subjected to confirmation by polymerase chain reaction as follows.

Preparation of broth culture of Klebsiella

The bacterial isolates were cultivated by inoculating in BHI (Hi Media) and incubating at 37 ^ °C for 12-18 hours (overnight grown culture).

Extraction of DNA

DNA extraction was performed using the GenElute Bacterial Genomic DNA Kit, following the manufacturer's instructions:

• Centrifuged 1.5 mL of overnight bacterial culture at 12,000-16,000 × g for 2 minutes, discarding the culture medium.

• Resuspended the pellet in 180 μL of Lysis Solution T/Buffer.

• Added 20 μL of Proteinase K, mixed, and incubated at 55 ^ °C for 30 minutes.

• Added 200 μL of Lysis Solution C, vortexed, and incubated at 55 ^ °C for 10 minutes.

• Added 500 μL of Column Preparation Solution to a preassembled binding column and centrifuged at 12,000 × g for 1 minute; discarded the eluate.

• Added 200 μL of ethanol (95-100%), vortexed, and mixed thoroughly.

• Transferred the lysate into the binding column, centrifuged at≥6500×g for 1 minute, and discarded the eluate.

• Added 500 μL of Wash Solution 1, centrifuged at≥6500×g for 1 minute, and discarded the eluate.

• Added 500 μL of Wash Solution, centrifuged at 12,000-16,000 × g for 3 minutes to dry the column.

• Added 200 μL of Elution Solution, centrifuged at ≥6500×g for 1 minute to elute the DNA.

• Stored the extracted DNA at -20 °C.

Polymerase chain reaction (PCR)

PCR was standardized for detecting Klebsiella by targeting the genus-specific Klebsiella gyrA gene and two species-specific genes: 16S-23S ITS and pehX for K. pneumoniae respectively using published primers (Table 02). The PCR mix was prepared as shown in Table 03.

Target gene Primer Sequence Product size (bp) Reference

Klebsiella gyr A F:CGCGTACTATACGCCATGAACGTAR: ACCGTTGATCACTTCGGTCAGG 441 Younis et al., 2017 [5] K. pneumoniae 16S-23S ITS F: ATTTGAAGAGGTTGCAAACGATR:TTCACTCTGAAGTTTTCTTGTGTTC 130 Younis et al., 2017 [5] K. oxytoca peh X F: GATACGGAGTATGCTTTACGGTGR:TAGCCTTTATCAAGCGGATACTGG 343 Younis et al., 2017 [5] Thermocyclic conditions for identification of Klebsiella genus PCR was performed in an Eppendorf thermocycler for Klebsiella identification targeting the gyrA gene. The protocol included: initial denaturation at 94 °C for 5 minutes, annealing at 60 °C for 45 seconds, and extension at 72 °C for 10 minutes.

Thermocyclic conditions for identification of K. pneumoniae PCR conditions for identification of K. pneumoniae targeting I6S-23SITS gene included initial denaturation at 94 °C for 5 minutes, annealing at 58 °C for 30 seconds and extension at 72 °C for 10 minutes.

Agarose gel electrophoresis

The amplified PCR products were electrophoresed in a 1.5% agarose gel (Sigma Aldrich) prepared in 1X TBE buffer (Genie) and stained with ethidium bromide. The gel was set with a gel comb, allowed to solidify, and placed in an electrophoresis tank with TBE buffer. PCR samples, mixed with 6X bromophenol blue dye, were loaded with a 100+ bp DNA ladder.

Electrophoresis was run at 90 volts/cm for 1 hour. Bands were visualized using a UV transilluminator and digitally recorded with a gel documentation system (Alphalmager, USA).

Results and Discussion

A total of 150 samples were collected from poultry birds and farm environments, 38 produced lactose-fermenting pink colonies on MCA after incubation. Of these, 17 isolates produced highly mucoid, viscous, pink colonies on Mac Conkey agar (Fig 1), forming a large string when lifted with a bacteriological loop (Fig 4). These isolates were identified as Gram-negative rods (Fig 2 ) and exhibited a thick capsule on negative staining (Fig 5). The colonies were streaked onto EMB agar, where no metallic sheen was observed (Fig 3). Based on these colonial and morphological characteristics, the 17 isolates were tentatively identified as Klebsiella spp.

On biochemical characterization these 17 strains were found catalase positive (FIGURE 6), oxidase negative (FIGURE 7), produced acidic butt and slant with gas but no H₂S production in TSI slants (FIGURE 8), and •, •,+,+ in IMViC reactions(FIGURE 9 to 12) . Additionally, all isolates were urease producers (FIGURE 13) and glucose fermenters (FIGURE 14), consistent with Klebsiella spp.

Genotypic Identification of Klebsiella Isolates

The phenotypically identified Klebsiella isolates were confirmed genotypically via PCR with gyrA primers targeting the genus-specific gene. All 17 isolates yielded the expected 441 bp product (FIGURE 15), consistent with the methods of Aly et al. (2014) [6] , Younis et al. (2016) [7] , and Modh et al.

(2021) [8] . Additionally, 12 of the 17 isolates (70.58%) were identified as K. pneumoniae, producing the 130 bp PCR product for the species-specific 16S-23S ITS gene (FIGURE 16). Klebsiella, a natural inhabitant of the gastrointestinal tract in humans, animals, and birds, was isolated from cloacal swabs of healthy birds in this study, highlighting its role as a constituent of the gut microbiome. The prevalence of Klebsiella is presented in Table 04.

References

1. Singh BR. ESKAPE pathogens in animals and their antimicrobial drug resistance pattern. Journal of Dairy, Veterinary & Animal Research. 2018;7(3):1-0.
2. Kot B, Witeska M. Review of antimicrobial resistance of Klebsiella pneumoniae isolated from poultry, cattle and pigs. animal. 2024 Sep 26:101345.
3. Chaudhry, T. H., Aslam, B., Arshad, M. I., Alvi, R. F., Muzammil, S., Yasmeen, N., … Baloch, Z. (2020). Emergence of blaNDM-1 Harboring Klebsiella pneumoniae ST29 and ST11 in Veterinary Settings and Waste of Pakistan. Infection and Drug Resistance, 13, 3033-3043.https://doi.org/10.2147/IDR.S248091
4. Barrow, G.I. and Feltham, R.K.A. (1993). Cowan and Steel's manual for the identification of medical bacteria, 3rd edn. Cambridge University Press, Cambridge.
5. Younis, A.I., Elbialy, A.I., Abo Remila, E.M. and Ammar, A.M. (2017). Molecular Detection of Genus Klebsiella and Genotypic Identification of Klebsiella pneumoniae and Klebsiella oxytoca by Duplex Polymerase Chain Reaction in Poultry, Global Veterinaria, 18 (3): 234-241.
6. Aly, M.M., Khalil, S. and Metwaly, A. (2014). Isolation and molecular identification of Klebsiella microbe isolated from chicks. Alexandria Journal for Veterinary Sciences, 43: 97-103.
7. Younis, G., Awad, A., El-Gamal, A. and Hosni, R. (2016). Virulence properties and antimicrobial susceptibility profiles of Klebsiella species recovered from clinically diseased broiler chicken. Advances in Animal and Veterinary Sciences. 4 (10): 536-542.
8. Modh, K.S., Parmar, B.C., Chaudhary, J.H., Bhanderi, B.B., Nayak, J.B., Thakur, S., Pargi, Z.B. and Patel, N.M. (2021). Molecular Detection of Klebsiella spp from Poultry Meat. International Journal of Pure and Applied Bioscience., 9 (1): 511-518.
9. Tantawy, M., Amer, H.A., El-Khyate, F.F. and El-Abasy, M. (2018). Klebsiella pneumoniae infection in broiler chickens. Kafrelsheikh Veterinary Medical Journal, 16: 1742.
10. Elgaos, M.I., Mahmoud, A. and Ahmed, H. (2019). Molecular characterization of some virulence genes in Klebsiella pneumoniae isolated from broilers. Assiut Veterinary Medical Journal, 65 (161): 85-94.
11. Holt, K.E., Wertheim, H., Zadoks, R.N., Baker, S., Whitehouse, C.A., Dance, D., Jenney, A., Connor, T.R., Hsu, L.Y., Severin, J. and Brisse, S. (2015). Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health. Proceedings of the National Academy of Sciences, 112 (27): 3574-E3581.
12. Effah, C.Y., Sun, T., Liu, S. and Wu, Y. (2020). Klebsiella pneumoniae: An increasing threat to public health. Annals of Clinical Microbiology and Antimicrobials, 19(1): 1-9.
13. Gundagon, N., Citak, S. and Yalcine, E. (2011). Virulence properties of extended spectrum β-Lactamase-producing Klebsiella species in meat samples. Journal of Food Protection, 74: 559-564.
14. Fielding, B.C., Mnabisa, A., Gouws, P.A. and Morris, T. (2012). Antimicrobial-resistant Klebsiella species isolated from free-range chicken samples in an informal settlement. Archives of Medical Science: AMS, 8 (1): 39.
15. Mahanti, A., Ghosh, P., Samanta, I., Joardar, S.N., Bandyopadhyay, S., Bhattacharyya, D., Banerjee, J., Batabyal, S., Sar, T.K. and Dutta, T.K. (2018). Prevalence of CTX-M-producing Klebsiella spp. in broiler, kuroiler, and indigenous poultry in West Bengal state, India. Microbial Drug Resistance, 24: 299-306.
16. Eibach, D., Dekker, D., Boahen, K.G., Akenten, C.W., Sarpong, N., Campos, C.B., Berneking, L., Aepfelbacher, M., Krumkamp, R., Owusu-Dabo, E. and May, J. (2018). Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in local and imported poultry meat in Ghana. Veterinary Microbiology, 217: 712.
17. Tewari, R., Mitra, S., Venugopal, N., Das, S., Ganaie, F., Sen, A., Shome, R., Rahman, H. and Shome, B.R. (2019). Phenotypic and molecular characterization of extended spectrum β-lactamase, ampc β-lactamase and metallo βlactamase producing Klebsiella spp. from farm animals in India. Indian Journal of Animal Research, 53: 938-943.
18. Abdul-Razzaq MS, Al-Khafaji JKT, Al-Maamory EHKA. Molecular characterization of capsular polysaccharide genes of Klebsiella pneumoniae in Iraq. International Journal of Current Microbiology and Applied Sciences. 2014;3(7):224-34.