Development and validation of high β-Carotene Maize (Zea mays L.) lines through marker-assisted introgression of the crtRB1 allele

Introduction

Maize (Zea mays L.) is a paramount cereal crop cultivated extensively worldwide, utilized for human consumption, livestock feed, and industrial raw materials. Possessing the highest production among all cereals, worldwide maize output reached 861 million tonnes in 2015-16, providing up to 61% of the caloric intake in various developing countries (Shiferaw et al., 2013 and Satyanarayana, 2024) [25,22] . While a typical maize kernel is calorie-dense, comprising approximately 73% starch and 9% protein commonly cultivated varieties suffer from a severe deficiency in provitamin A (PVA) carotenoids, typically accumulating a mere 0.15 to 1.5 µg/g (Harjes et al., 2008) [8] . This micronutrient shortfall significantly contributes to Vitamin A deficiency (VAD), a crisis that causes blindness in children and women, increases mortality rates globally, and severely impacts developing nations (Zunjare et al., 2018) [36] . Unlike other major cereals, maize uniquely synthesizes coloured carotenoid compounds in its endosperm that the human body can metabolize into vitamin A (Bouis and Welch, 2010; Wurtzel, 2004) [4,34] . In the carotenoid biosynthetic pathway, the crtRB1 gene (encoding β-carotene hydroxylase 1) is critical; it converts β-carotene (which holds 100% provitamin A activity) into downstream, non-PVA compounds like β-cryptoxanthin and zeaxanthin (Babu et al., 2013) [3] . Natural genetic variation in the crtRB1 3'TE region results in three allelic forms. Crucially, the favourable allele 1 (543 bp, without insertion) reduces transcript expression, stunting the hydroxylation of β-carotene and promoting its accumulation in the endosperm (Yan et al., 2010 and Vinodhana et al., 2025) [35,32] . Biofortification which is, the enhancement of crop nutritional value through breeding offers a highly sustainable and cost-effective strategy to combat "hidden hunger" (Qaim et al., 2007; Hotz and Mcclafferty, 2007) [19,9] . Through Marker-Assisted Selection (MAS), breeders can bypass lengthy phenotypic evaluations by tracking target alleles directly, vastly accelerating the breeding cycle (Tanksley et al., 1989; Warburton et al., 2010 and Natesan et al.,2020) [31,33,15] . However, for biofortified crops to be adopted by farmers, they must pair enhanced nutrition with superior agronomic performance. This requires the thorough evaluation of General Combining Ability (GCA) and Specific Combining Ability (SCA) to harness heterosis, as yield is a highly complex quantitative trait (Sprague and Tatum, 1942) [29] .

Materials and Methods

Plant genetic materials and hybridization

The breeding material comprised of 11 highly adapted elite inbred lines (N 5, N 14, N 27, N 42, N 66, N 90, N 94, N 104, N 107, N 117, and N 285) acting as female lines which were developed by Department of Biotechnology, Agricultural College and Research Institute, Madurai, and two high betacarotene converted Universal Maize Inbreds (UMI 1200-7-26-1-6-1 and UMI 1230-2-70-9-6-1) acting as testers, which were developed at Department of Millets, Centre of Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore. Crossing was executed utilising the Line × Tester (L × T) mating design via the tassel bag method to generate 22 F1 cross combinations. Parents, hybrids along with two standard checks CO 6 and NK 6240 were evaluated in a Randomized Block Design (RBD) with two replications. The experiment was carried out in Agricultural Research Station, Bhavanisagar, TamilNadu.

Marker-Assisted Screening (MAS) for the crtRB1 Allele

Genomic DNA was isolated from 15-20 days old seedlings using a modified Cetyl Trimethyl Ammonium Bromide (CTAB) extraction buffer protocol (Dellaporta, 1983) [5] . DNA quality was verified via 0.8% agarose gel electrophoresis. Polymerase Chain Reaction (PCR) amplification utilized crtRB1 3'TE gene-specific primers (65F: ACACCACATGG ACAAGTTCG, 62R: ACACTCTGGCCCATGAACAC, 66R: ACAGCAATACAGGGGACCAG) was carried out following the procedure of Muthusamy et al. (2014) and was used for foreground selection. SSR primer sequences were obtained from Eurofins Ltd, Bangalore. The amplified products were resolved on a 3% agarose gel to detect the favourable allele 1 (543 bp) and unfavourable allele 2 (296 bp).

Biometrical evaluation

Sixteen quantitative traits were recorded which includes days to 50% tasselling (days), Days to 50% silking (days), plant height (cm), Leaf length (cm), Leaf width (cm), Length to first cob (cm), number of branches per tassel, Tassel length (cm), cob length (cm), cob girth (cm), cob weigh (g), Number of kernel rows per ear, Number of kernels per row, 100-grain weight (g), single plant grain yield (g) and Shelling percentage (%) which were recorded according to the plant stage based on the standard maize descriptors formulated by IBPGR (Annon, 1991) [2] .

Statistical Analysis

Analysis of variance (ANOVA) (Panse and Sukhatme, 1964) [16] . and combining ability parameters (GCA and SCA) were estimated. Standard heterosis was computed relative to checks. Genotypic correlation and path coefficient analyses (Dewey and Lu, 1959) were conducted to establish relationships between yield and morphological traits using the TNAU stat, software.

Dissection of gene action and combining ability

Analysis of Variance revealed highly significant differences among parents and hybrids for all 16 morphological and yield traits, validating the extensive genetic diversity present in the chosen germplasm (

Deep profiling of agronomic performance and heterosis

Evaluated by per se performance and GCA, the elite line N14 proved to be the paramount general combiner. It exhibited highly significant positive GCA effects for single plant yield (23.81), cob weight (25.84), 100-grain weight (6.55), and shelling percentage (3.02) (Table 2). Considering commercial hybrids CO 6 and NK 6240 as checks, 18 hybrids showed significantly positive heterosis for days to 50% tasselling, ranging from 0.99% to 10.89% over CO 6 and NK 6240 (Table 5). For days to 50% silking, significant positive heterosis ranged from 2.86% to 11.43% over CO 6 and 0.93% to 9.35% over NK 6240. Five hybrids ranged from -29.69% to 15.80%, and fifteen hybrids ranged from -15.87% to 38.56%, showing significant positive heterosis over the check CO 6 and NK 6240, respectively, for plant height. For cob length, the degree of increase of heterosis ranged from -11.15% to 26.63% and -24.6% to 7.47%, with 16 hybrids exhibiting positive heterosis over CO 6 and none of the hybrids expressing positive heterosis over NK 6240, respectively. For cob girth, the increase in heterosis ranged from -10.05% to 10.96% and from -2.65% to 20.09% over CO 6 and NK 6240, respectively, and 7 hybrids for CO 6 and 13 hybrids for NK 6240 exhibited positive heterosis. The degree of increase in cob weight ranged from -43.43% to 19.83% and from -27.88% to 52.79% over CO 6 and NK 6240, respectively; 3 hybrids over CO 6 and 14 hybrids over NK 6240 exhibited positive heterosis. For shelling percentage, 6 hybrids each exhibited positive heterosis. The heterotic value ranged from -16.47% to 6.5% over CO 6 and -15.936% to 7.19% over NK 6240. For 100-grain weight, none of the hybrids showed positive heterosis over CO 6, but it showed negative heterosis ranging from -35.3% to -1.12% over CO 6. These were in accordance with the results of ( [10,6,27,28,24] . When combined with the beta-carotene donor tester UMI 1200-7-26-1-6-1, the resulting hybrid, N14 × UMI 1200-7-26-1-6-1, displayed explosive heterosis i.e., for Absolute Yield with the highest single plant yield across the entire trial at 147.23 g, dramatically outperforming the overall hybrid mean of 95.33 g (Table 6 and7). In terms of Cob Dimensions, it achieved a massive cob weight of 194.79 g and a shelling percentage of 76.99%. Further, the cross demonstrated an exceptional SCA effect of 33.08 for grain yield, proving exceptional genetic complementation. Finally, the standard heterosis which indicates translation of biological vigor to commercial viability, N14 × UMI 1200-7-26-1-6-1 cross achieved highly significant standard heterosis for grain yield, registering a 26.73% increase over the benchmark CO 6 check and a massive 51.01% increase over the NK 6240 check and also the cob features showed the good phenotypic expression of these traits (Figure 2), this was in corroborated with the results of (Premalatha, 2006; Talukder et al., 2016 and Ismail et al., 2026) [17,30,11] over checks.

Trait Associations: Correlation and Path Analysis

To understand the actionable indirect selection criteria, phenotypic and genotypic correlations were scrutinized. Genotypic correlations were consistently higher than phenotypic correlations. Grain yield per plant exhibited highly significant, strong positive genotypic correlations with cob weight (0.9696), number of kernels per row (0.7889), cob length (0.7357), and cob girth (0.7361) (Table 8). Therefore, these were important for improving grain yield per plant. Path coefficient analysis unveiled that Days to 50% Tasselling (3.7246), Plant Height (1.7669), and Cob Length (1.0943) exerted the maximum positive direct effects on grain yield (Table 9). Conversely, Days to 50% Silking (-3.9598) exerted a massive negative direct effect on yield. The residual effect determines how best the causal factors account for the variability of the dependent factor. Low residual value in this study indicated the adequacy of the characters included in the present study. Thus, to achieve targeting yield in biofortified maize selection for taller plants with extended cob lengths and early silking characteristics will be effective as these are fundamental geometric and temporal drivers of kernel weight which will also reduce the undesirable effect of the component traits studied.

Discussion

The comprehensive findings of this study validate the immense technical feasibility and efficiency of MAB in developing elite, nutritionally dense maize. The molecular verification that the favourable 543 bp allele restricts downstream β-carotene conversion thus forcing endosperm accumulation corroborates earlier foundational reports indicating that targeted regulation at the crtRB1 locus solves PVA deficiency without causing yield penalties (Yan et [35,3,23,18] . In evaluating combining ability, the overwhelming statistical superiority of SCA variances over GCA variances confirms that yield traits in these diverse populations are primarily governed by non-additive interactions (dominance and epistasis). This strongly aligns with the observations reported by Aminu et al. (2014) [1] , Rajitha et al. (2014) [20] , and Saripalli et al. (2017) [21] . Crossing geographically and genetically distinct parents (adapted lines with donor testers) forcefully leveraged this variance. The N 14 × UMI 1200-7-26-1-6-1 hybrid capitalized perfectly on this heterosis, vastly out-yielding elite commercial checks. Furthermore, the path analyses identifying cob length and plant height as primary direct drivers of grain yield refine the morphological target for breeders, mirroring conclusions by [26,14,13,11] .

Conclusion

The integration of marker-assisted selection for the crtRB1 3'TE allele with conventional Line × Tester breeding is a highly efficient, rapid methodology to generate elite biofortified maize hybrids. Through rigorous biometrical, molecular, and biochemical evaluation, the hybrid N 14 × UMI 1200-7-26-1-6-1 was definitively identified as the paramount genotype. Achieving a massive single plant grain yield of 147.23 g with over 51% standard heterosis, alongside a sharply elevated betacarotene content of 6.27 µg/g, this hybrid resolves the conflict between yield drag and nutritional enhancement. In the future, this hybrid can be further advanced through marker assisted backcross breeding to develop high beta carotene maize.

References

1. Aminu D, Dawud MA, Modu A. Combining ability and heterosis for different agronomic traits in maize (Zea mays L.) under drought stress in the Sudan Savanna of Borno State, Nigeria. Plant Breeding and Crop Science. 2014;6(10):128-134.
2. Anonymous. Descriptors for Maize. Mexico City: International Board for Plant Genetic Resources; 1991. p.86.
3. Babu R, Rojas NP, Gao S, Yan J, Pixley K. Validation of the effects of molecular marker polymorphisms in LcyE and CrtRB1 on provitamin A concentrations for 26 tropical maize populations. Theoretical and Applied Genetics. 2013;126(2):389-399.
4. Bouis HE, Welch RM. Biofortification a sustainable agricultural strategy for reducing micronutrient malnutrition in the global south. Crop Science. 2010;50(Suppl 1):S20-S32.
5. Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter. 1983;1(4):19-21.
6. Devi B, Barua NS, Barua PK, Talukdar P. Analysis of midparent heterosis in a variety diallel in rainfed maize. The Indian Journal of Genetics and Plant Breeding. 2007;67(2):200-202.
7. Dewey DR, Lu K. A correlation and path-coefficient analysis of components of crested wheatgrass seed production. Agronomy Journal. 1959;51(9):515-518.
8. Harjes CE, Rocheford TR, Bai L, Brutnell TP, Kandianis CB, Sowinski SG, et al. Natural genetic variation in lycopene epsilon cyclase tapped for maize biofortification. Science. 2008;319(5861):330-333.
9. Hotz C, McClafferty B. From harvest to health: challenges for developing biofortified staple foods and determining their impact on micronutrient status. Food and Nutrition Bulletin. 2007;28(2 Suppl):S271-S279.
10. Immanuel S, Naarajan P, Das V. Heterotic expression and combining ability analysis for qualitative and quantitative traits in inbreds of maize. Crop Research. 2006;32(1):7785.
11. Ismail MR, Hassan MAA, El-Mouslhy TT. Harnessing combining ability estimates to classify newly developed maize inbred lines. Madras Agricultural Journal. 2026;113(1-3):1.
12. Kage U, Lohithaswa HC, Shekara BG, Shobha D. Combining ability studies in maize (Zea mays L.). Molecular Plant Breeding. 2013;4(2):123-127.
13. Kumar R, Dubey RB, Ameta KD, Kunwar R, Verma R, Bisen P. Correlation and path coefficient analysis for yield contributing and quality traits in quality protein maize (Zea mays L.). International Journal of Current Microbiology and Applied Sciences. 2017;6(10):2139-2146.
14. Nataraj V, Shahi JP, Agarwal V. Correlation and path analysis in certain inbred genotypes of maize (Zea mays L.) at Varanasi. International Journal of Innovative Research and Development. 2014;3(1):14-17.
15. Natesan S, Duraisamy T, Pukalenthy B, Chandran S, Nallathambi J, Adhimoolam K, et al. Enhancing β-carotene concentration in parental lines of CO6 maize hybrid through marker-assisted backcross breeding (MABB). Frontiers in Nutrition. 2020;7:134.
16. Panse VG, Sukhatme PV. Statistical Methods for Agricultural Workers. New Delhi: ICAR; 1954.
17. Premalatha. Combining ability and heterosis analysis for grain yield components and quality traits in maize (Zea mays L.) [MSc thesis]. 2006.
18. Pukalenthy B, Manickam D, Chandran S, Adhimoolam K, Sampathrajan V, Rajasekaran R, et al. Incorporation of opaque-2 into UMI 1200, an elite maize inbred line, through marker-assisted backcross breeding. Biotechnology and Biotechnological Equipment. 2019;33(1):144-153.
19. Qaim M, Stein AJ, Meenakshi JV. Economics of biofortification. Agricultural Economics. 2007;37:119133.
20. Rajitha A, Babu DR, Rao VS. Heterosis and combining ability for grain yield and yield component traits in maize (Zea mays L.). Electronic Journal of Plant Breeding. 2014;5(3).
21. Saripalli Varalakshmi SV, Wali MC. Combining ability and heterosis studies in single cross hybrids synthesized from CIMMYT-based inbred lines of maize (Zea mays L.). Journal of Farm Sciences. 2017;30(3):320-325.
22. Satyanarayana S. Increasing the beta-carotene content of rice, maize, and potatoes through genetic modification. International Journal of High School Research. 2024;6(1):1-7.
23. Selvi DT, Senthil N, Yuvaraj A, Joel AJ, Mahalingam A, Nagarajan P, et al. Assessment of crtRB1 polymorphism associated with increased β-carotene content in maize (Zea mays L.) seeds. Food Biotechnology. 2014;28(1):41-49.
24. Sharma P, Kamboj MC, Singh N, Chand M. Heterosis for grain yield and quality traits in maize (Zea mays L.). International Journal of Pure and Applied Bioscience. 2017;5(5):241-248.
25. Shiferaw B, Smale M, Braun HJ, Duveiller E, Reynolds M, Muricho G. Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security. Food Security. 2013;5(3):291-317.
26. Shinde SA, Shelki DK, Sawargaonkar GL. Intercharacter associations and path analysis of yield components in rabi maize. International Journal of Plant Sciences. 2009:49-51.
27. Shukla N, Chavan A, Mishra DK. Heterosis and combining ability analysis for yield attributing traits in desi and quality protein maize (Zea mays L.). Green Farming. 2016;7(5):1040-1044.
28. Singh SB, Gupta BB, Singh AK. Heterotic expression and combining ability analysis for yield and its components in maize (Zea mays L.) inbreds. Progressive Agriculture. 2010;10(2):275-281.
29. Sprague GF, Tatum LA. General vs. specific combining ability in single crosses of corn. Agronomy Journal. 1942;34(10):923-932.
30. Talukder MZA, Karim AS, Ahmed S, Amiruzzaman M. Combining ability and heterosis on yield and its component traits in maize (Zea mays L.). Bangladesh Journal of Agricultural Research. 2016;41(3):565-577.
31. Tanksley SD, Young ND, Paterson AH, Bonierbale MW. RFLP mapping in plant breeding: new tools for an old science. Biotechnology. 1989;7(3):257-264.
32. Vinodhana NK, Ravikesavan R, Senthil N, Sivakumar S, Datta HM, Mohanapriya B. Enrichment of β-carotene content in maize inbred UMI 1201 through marker-assisted backcross breeding. Electronic Journal of Plant Breeding. 2025;16(3):323-330.
33. Warburton ML, Setimela P, Franco J, Cordova H, Pixley K, Bänziger M, et al. Toward a cost-effective fingerprinting methodology to distinguish maize openpollinated varieties. Crop Science. 2010;50(2):467-477.
34. Wurtzel ET. Genomics, genetics, and biochemistry of maize carotenoid biosynthesis. In: Recent Advances in Phytochemistry. Vol. 38. Elsevier; 2004. p.85-110.
35. Yan J, Kandianis CB, Harjes CE, Bai L, Kim EH, Yang X, et al. Rare genetic variation at Zea mays crtRB1 increases β-carotene in maize grain. Nature Genetics. 2010;42(4):322-327.
36. Zunjare RU, Hossain F, Muthusamy V, Baveja A, Chauhan HS, Bhat JS, et al. Development of biofortified maize hybrids through marker-assisted stacking of β-carotene hydroxylase, lycopene-ε-cyclase and opaque2 genes. Frontiers in Plant Science. 2018;9:178.