Genetic characterization of Anaplasma marginale infecting bovines in India

Introduction

Bovine anaplasmosis also known as gall sickness, is a tick born rickettsial disease caused by an obligate intra-erythrocytic pathogen belonging to the genus Anaplasma, family Anaplasmataceae, order Rickettsiales (Aktas and Ozubek, 2017) [1] . The genus comprises seven recognized species namely A. centrale, A. marginale, A. bovis, A. caudatum, A. ovis, A. platys and A. phagocytophilum (Hove et al., 2018) [8] . Among these, A. marginale is the most pathogenic and principle aetiological agent for bovine anaplasmosis worldwide, causing substantial economic losses to livestock industry in temperate, tropical and subtropical regions (Kocan et al., 2003) [12] . In India, anaplasmosis is ranked among the top 10 rickettsial diseases of ruminants (PDADMAS, 2005) [20] . The disease primarily affects adult cattle and characterised by progressive haemolytic anaemia. The organism appears as small, spherical, red stained bodies within the erythrocytes (at the periphery of cell) on Giemsa-stained blood smears (Soulsby, 1982) [23] . Transmission of A. marginale occurs biologically through several tick genera involving Rhipicephalus, Hyalomma, Dermacenter, Ixodes and Argas, with Rhipicephalus (Boophilus) microplus recognized as principle vector in India (Kolte et al., 2017) [13] . Mechanical transmission may also occur via biting flies, mosquitoes and contaminated instruments such as needles, syringes, dehorning and castration equipment's (Marchette and Stiller, 2018) [17] .

Trans-placental transmission has also been described in cattle (Kocan et al., 2015) [11] . Amaro-Estrada et al. (2020) [3] [18,4] [22,1,24] . In general, severity of haemoparasitc infection is determined by parasite and host related several factors including the parasite strain or genotype, virulence, quantum of infection besides host susceptibility and age. Further, in order to assess the virulence of a parasitic strain, comparative genetic analysis is playing very important role. However, very limited information is available on genetic characterization of A. marginale from India. Keeping in view, the present study was undertaken to characterize the locally circulating A. marginale infecting bovine population in India targeting the msp5 gene.

Materials and Methods

Blood sample collection and microscopic examination

Blood samples (approx. 3ml) were collected from a total of 721 bovines of four North Indian States (Uttar Pradesh-339, Uttarakhand-101, Haryana-131 and Rajasthan-150) and transported to the laboratory in cold chain. In the laboratory, thin blood smear was prepared from all the samples and microscopy was performed following staining with Giemsa stain. A total of 8 representative Anaplasma sp. positive samples were utilized for genomic DNA isolation.

Isolation of genomic DNA

Out of 61 microscopically positive blood samples for A. marginale, a total of 8 isolates (UP-2, UK-1, HR-3 and RJ-2) were used for genomic DNA isolation using Qiagen Blood DNA isolation kit. The recovered DNA was tested for its concentration and purity using Nanodrop spectrophotometer.

PCR amplification of major surface protein 5 (msp5) gene

Targeted gene was PCR amplified using gene specific primer pair (msp5-For: GCATAGCCTCCGCGTCTTTC and msp5-Rev: TCCTCGCCTTGGCCCTCAGA). PCR reaction was performed in 25 μl total volume containing 30 ng of template DNA, 2.5 μl of 10× PCR Green buffer (Puregene), 0.5 μl of 10mM dNTP, 0.5 μl of each forward and reverse primer (20 pmol/μl), 0.2 μl Dream Taq DNA polymerase and nuclease free water to make the volume 25 μl. PCR amplification (primary) was performed using a S1000 thermal cycler Bio-Rad, USA) under optimized conditions as follows: initial denaturation at 94 °C for 5 min, followed by 35 amplification cycles (94 °C for 45s, 58 °C for 45s and 72 °C for 90s) and a final extension step at 72 °C for 10 min. Known A. marginale DNA was used as positive control, while nuclease free water (NFW) was used as negative control. The PCR products was electrophoresed in 1.5% agarose gel (Tris-borate-EDTA), stained with ethidium bromide and visualized under UV light. After confirming gene specific amplification in primary PCR, a bulk PCR reaction (25 μl volume in triplicate) was run for each one of the selected isolate. Amplified product was analysed in agarose gel electrophoresis as above and then the specific band was excised from the gel. Thereafter, PCR product was purified using the gel extraction kit (Qiagen) and concentration as well as purity of the each elute was analysed using the Nanodrop spectrophotometer. Finally, purified fragment of a total of 8 isolates was then submitted for custom DNA sequencing.

Sequence analysis

The raw data obtained with respect to different isolates of msp5 gene was analysed and submitted to the DNA database of NCBI. Subsequently, accession numbers were obtained for all newly generated sequences. Newly generated sequences of msp5 gene were subjected for homology search analysis using the BLAST programme of the NCBI database. Further, representative sequences were also downloaded from the NCBI database for its utilization in the phylogenetic analysis.

Phylogenetic analysis

A total of 8 newly generated gene sequences of msp5 gene (457 bp) were used to established the phylogenetic tree of A. marginale circulating in North India. A total of 19 published sequences were also retrieved from nucleotide database using the nucleotide BLAST program of the NCBI. In order to align all the sequences, most sequences were truncated at both ends using the MegAlign program of DNASTAR software. Lastly, phylogenetic tree was constructed using the Maximum Likelihood method using the Tamura-Nei parameter as best substitution model.

Results

Microscopic examination

Examination of Giemsa-stained blood smear recorded 8.46% overall positivity (61 samples detected positive) for A. marginale infection. Infection was recorded relatively high in Rajasthan than the other states included in the study. Level of parasitemia was mild to moderate indicating persistence of chronic infection in animals (Fig. 1).

Genetic characterization A. marginale using msp5 gene

Optimization of PCR assay revealed specific amplification of msp5 gene of A. marginale (Fig. 2). Raw sequence data obtained for all 8 isolates were analysed and submitted in GenBank database and subsequently accession numbers were obtained (OR333505 to OR333512). BLAST search analysis of these sequences recorded 100% sequence similarity with published isolates from different countries including Sri Lanka (LC467711) and India (LC706302). Sequence alignment study involving a total of 26 isolates (8 newly generated & 19 published) recorded very high level of sequence similarity amongst the isolates. The phylogenetic tree constructed based on the Maximum Likelihood method and Kimura-2 parameter model using the MEGA 11 software (Fig. 3) revealed clustering of all isolates in a single clade along with the majority of the published sequences (98 bootstrap value) included for establishing the phylogenetic tree (Table 1). Further, the sequences of A. ovis (OP244855) and A. centrale (AY054384) included in the study as out group member were placed at the bottom of the tree (Fig. 3).

Discussion

Tick borne haemoparasitic diseases are the major health concern in bovine population especially in tropical and subtropical part of the world including India. The most common tick borne diseases infecting bovines are; bovine tropical theileriosis, bovine babesiosis and anaplasmosis. Animals may be infected with single or mixed species infection depending on infestation by multiple species of ticks on the animal body. Bovine Anaplasmosis caused by Anaplasma marginale is transmitted by many genera of ticks including Rhipicephalus, Hyalomma, Dermacenter and Ixodes, besides the mechanical means through the bites of flies and mosquitoes (Marchette and Stiller, 2018) [17] . Disease can also be transmitted accidently via syringes, needles, ear tagging, dehorning saws, castration, and other contaminated surgical equipment (Demessie and Derso, 2015) [6] . Bovine anaplasmosis has very serious impact on the health and production of animals in India. Further, variable prevalence rate of A. marginale infection has already been recorded from different parts of the country. The global and national prevalence of Anaplasma infection was estimated through a meta-analysis by Paramanandham et al. (2019) [19] . The study reported a higher prevalence of anaplasmosis in South America, whereas India showed a comparatively lower prevalence than the global average. In India, the overall prevalence was 11%, with the highest occurrence (61%) in the central zone and the lowest (6%) in the western and southern zones. The clinical signs produced in anaplasmosis are general in nature and that includes high fever, anaemia, icterus, inappetence, dyspnoea, tachycardia, lymphadenopathy, weakness, loss of body weight and depression. Further, morbidity rate may be very high, if animals are already under stress condition (extreme weather, transportation, pregnancy, lactation). Clinical infection can be easily diagnosed by the microscopic examination methods, but it is very difficult if infection is in carrier stage (post recovery, chronic infection). Such carrier animals are playing major role in the maintenance of infection in a given geographical area and hence determination of real prevalence of individual parasitic agent is very much essential (Minjauw and McLeod 2003; Kahn, 2005) [18,9] . In the present investigation, microscopic examination of the blood smear revealed 8.46% overall prevalence of A. marginale. Genetic characterization of A. marginale was performed to ascertain that whether single genotype of this organism is in circulation or other variants are also circulating in the country. For this purpose, one of the reported genetic maker i.e. major surface protein 5 (msp5) gene was targeted. A total of 8 new sequences for different isolates were generated and used for establishing the phylogenetic tree along with 19 retrieved sequences. In the study, sequence variability was recorded almost negligible within the newly generated sequences. This least sequence variability resulted in the clustering of most of the isolates included (newly generated and retrieved) in a single clade, excepting one isolate from Cuba (AY527217). In a study, Kumar et al. (2015) [15] generated 5 sequences from Mathura region and found complete nucleotide homology in the sequences. As, this gene encodes an immunodominant protein and present across the genus including A. marginale, A. centrale, A. ovis and A. phagocytophilum (de la Fuente et al., 2005) [5] . Highly conserved nature of this gene (worldwide) made the choice for its use as an important diagnostic marker and developed cELISA for the recognition of anti-msp5 antibodies in bovine using purified recombinant (rMSP5) fusion protein (Knowles et al., 1996) [10] . Other workers have also performed phylogenetic analysis of A. marginale using different genetic markers from India (George et al., 2017; Kumar et al., 2019; Pradeep et al., 2019) [7,14,21] . George et al. (2017) [7] performed a study to investigate presence of A. marginale infection in cattle from Telangana and Seemandhra states using msp4 gene based PCR assay. Kumar et al. (2019) [14] assessed the presence of A. marginale in bovines and vector tick (Rhiphicephalus microplus) by microscopy and msp5 gene based PCR assay. Ticks were found present on the body of total 20 cattle (out of 39 A. marginale positive) and rickettsial infection was detected in 18 animals (90%) in infected animals. Pradeep et al. (2019) [21] revealed phylogenetic analysis of msp4 gene of Anaplasma spp. in bovines in Kerala, India. In the study, all the field isolates of A. marginale from Kerala clustered in a single clade with others isolated from around the world. The phylogenetic analysis of msp4 gene sequences confirmed the presence of A. marginale in the 10 isolates. Eight field isolates (Trissur-4,-5,-6,-7,-8, Wayanad-18,-20 and TVM-2) of Kerala clustered together along with isolates from around the world, including isolates from North America, South America and Asia, and revealed only minor levels of genetic diversity with intra-clade divergence of 0-0.9% within the msp4 gene. Lira-Amaya et al. (2022) [16] analysed the nucleotide sequences of gene of A. marginale from Mexico and reported sequence identities ranging from 96 to 99% among the isolates from Mexican water buffaloes.

Conclusion

The study recorded an overall prevalence of 8.46% of A. marginale infection based on blood smear examination, with a higher occurrence in Rajasthan. The mild to moderate parasitemia observed in the study suggests the presence of chronic carrier animals. PCR targeting the msp5 gene confirmed the infection, and sequence analysis showed 100% similarity with previously reported isolates from India and Sri Lanka. Phylogenetic analysis demonstrated that all isolates clustered in a single group, indicating high genetic similarity. These results confirm the circulation of genetically conserved A. marginale strains and support the use of molecular methods for accurate detection and surveillance of bovine anaplasmosis.

Acknowledgement

AcknowledgementThe authors are thankful to Director, ICAR-IVRI, Izatnagar for providing necessary facilities for completing this research work.

References

1. Aktas M, Ozubek S. Genetic diversity of major surface protein 1a of Anaplasma marginale in dairy cattle. Infection, Genetics and Evolution. 2021;89:104608.
2. Aktas M, Özübek S. Outbreak of anaplasmosis associated with novel genetic variants of Anaplasma marginale in dairy cattle. Comparative Immunology, Microbiology and Infectious Diseases. 2017;54:20-26.
3. Amaro Estrada I, García-Ortiz MA, Preciado de la Torre JF, Rojas-Ramírez EE, Hernández-Ortiz R, Alpírez-Mendoza F, et al. Transmission of Anaplasma marginale by unfed Rhipicephalus microplus tick larvae under experimental conditions. Revista Mexicana de Ciencias Pecuarias. 2020;11:116-131.
4. Awad H, Antunes S, Galindo RC, do Rosário VE, De la Fuente J, Domingos A, et al. Prevalence and genetic diversity of Babesia and Anaplasma species in cattle in Sudan. Veterinary Parasitology. 2011;181(2-4):146152.
5. De la Fuente J, Torina A, Caracappa S, Tumino G, Furlá R, Almazán C, et al. Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily. Veterinary Parasitology. 2005;133(4):357-362.
6. Demessie Y, Derso S. Tick borne hemoparasitic diseases of ruminants: A review. Advances in Biological Research. 2015;9(4):210-224.
7. George N, Bhandari V, Sharma P. Phylogenetic relationship and genotypic variability in Anaplasma marginale strains causing anaplasmosis in India. Infection, Genetics and Evolution. 2017;48:71-75.
8. Hove P, Khumalo ZT, Chaisi ME, Oosthuizen MC, Brayton KA, Collins NE. Detection and characterization of Anaplasma marginale and A. centrale in South Africa. Veterinary Sciences. 2018;5:26.
9. Kahn CM, Line S, Aiello SE. Urinary system. In: The Merck Veterinary Manual. Whitehouse Station (NJ): Merck & Co., Inc.; 2005. p. 1249-1287.
10. Knowles D, De Echaide ST, Palmer G, McGuire T, Stiller D, McElwain T. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. Journal of Clinical Microbiology. 1996;34(9):22252230.
11. Kocan KM, De La Fuente J, Cabezas-Cruz A. The genus Anaplasma: new challenges after reclassification. Revue Scientifique et Technique (Office International des Epizooties). 2015;34:577-586.
12. Kocan KM, De la Fuente J, Guglielmone AA, Meléndez RD. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clinical Microbiology Reviews. 2003;16:698-712.
13. Kolte SW, Larcombe SD, Jadhao SG, Magar SP, Warthi G, Kurkure NV, et al. PCR diagnosis of tickborne pathogens in Maharashtra state, India indicates fitness cost associated with carrier infections is greater for crossbreed than native cattle breeds. PLoS ONE. 2017;12(3):0174595.
14. Kumar N, Solanki JB, Varghese A, Jadav MM, Das B, Patel MD, et al. Molecular assessment of Anaplasma marginale in bovine and Rhipicephalus (Boophilus) microplus tick of endemic tribal belt of coastal South Gujarat, India. Acta Parasitologica. 2019;64(4):700709.
15. Kumar T, Sindhu N, Charaya G, Kumar A, Kumar P, Chandratere G, et al. Emerging status of anaplasmosis in cattle in Hisar. Veterinary World. 2015;8(6):768-770.
16. Lira-Amaya JJ, Santamaria-Espinosa RM, CastañedaArriola RO, Martínez-García G, Polanco-Martínez DJ, Rojas-Martínez C, et al. Molecular identification of Babesia spp. and Anaplasma marginale in water buffaloes in Veracruz and Tabasco, Mexico: A retrospective study. Microorganisms. 2022;10(9):1702.
17. Marchette NJ, Stiller D. Ecological Relationships and Evolution of the Rickettsiae. Vol I. Boca Raton: CRC Press; 2018.
18. Minjauw B, McLeod A. Tick-borne diseases and poverty: The impact of ticks and tick-borne diseases on the livelihoods of small-scale and marginal livestock owners in India and eastern and southern Africa. 2003.
19. Paramanandham K, Mohankumar A, Suresh KP, Jacob SS, Roy P. Prevalence of Anaplasma species in India and the world in dairy animals: A systematic review and meta-analysis. Research in Veterinary Science. 2019;123:159-170.
20. PDADMAS. Project Directorate on Animal Disease Monitoring and Surveillance-Annual Report. Indian Council of Agricultural Research; 2005. p.1-12.
21. Pradeep RK, Nimisha M, Sruthi MK, Vidya P, Amrutha BM, Kurbet PS, et al. Molecular characterization of South Indian field isolates of bovine Babesia spp. and Anaplasma spp. Parasitology Research. 2019;118(2):617-630.
22. Ramos CA, Araújo FR, Alves LC, de Souza IIF, Guedes DS Jr, Soares CO. Genetic conservation of potentially immunogenic proteins among Brazilian isolates of Babesia bovis. Veterinary Parasitology. 2012;187:548-552.
23. Soulsby EJL. Helminths, Arthropods and Protozoa of Domesticated Animals. London: Baillière Tindall; 1968.
24. Teja MMS, Mamatha GS, Lakkundi JN, Chandranaik BM, Murthy CMK, Gomes AR. Multiplex PCR for detection of Anaplasma marginale, A. bovis and A. platys in cattle. Journal of Parasitic Diseases. 2023;47(3):659-663.