Prevalence and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus in Milk and Meat of Small Ruminants in Southern Tamil Nadu

Introduction

Staphylococcus aureus is an opportunistic pathogen frequently associated with foodborne illnesses and development of antimicrobial resistance (Kadariya et al 2014). Its pathogenic potential is further enhanced by the continual emergence of new clonal lineages, rendering S. aureus a 'superbug' (Lakhundi and Zhang, 2018) [10] . MRSA is known to be a major threat to public health, as it accounts for 3 billion dollars in annual health costs (Lakhundi and Zhang, 2018) [10] . The emergence of MRSA in food producing animals has raised global concern, as contaminated milk and meat can act as reservoirs for transmission to humans through the food chain. Different LA-MRSA strains have been found in different foods, including milk, cheese, meat products and raw meat of chicken (Mostafa et al 2022) [12] . Goat milk contributes to 3 percent of total milk production across the Country. Small ruminants such as sheep and goats contribute substantially to milk and meat production in India, especially in Tamil Nadu, where these products are widely consumed (DAHD, 2023). While several studies have reported MRSA in various foods sources, such as poultry, pork, beef, milk and vegetables, suggesting that foods may serve as reservoirs (Wang et al 2014, Wu et al 2018) [17, 19] , limited information exists on its occurrence in small ruminant derived food products. In addition to antibiotic resistance, S. aureus strains producing classical enterotoxins (seasee) are of concern due to their involvement in staphylococcal food poisoning outbreaks worldwide (Argudin et al 2010) [1] . Detection of both resistance (mecA, femB) and enterotoxin genes in isolates from small ruminant products would provide essential insights into the dual risks of antimicrobial resistance and foodborne disease. Given the increasing global emphasis on antimicrobial resistance as a "One Health" challenge (WHO, 2021), this study aims to investigate the prevalence, molecular characterization and enterotoxin gene profiling of MRSA in milk and meat from small ruminants in Tirunelveli, Tuticorin,Tenkasi and Kanniyakumari districts. Findings from this work will serve as baseline data for risk assessment and formulation of preventive strategies to protect public health.

Materials and Methods

Study Area and Sample Collection

The study was carried out in four southern districts of Tamil Nadu: Tirunelveli, Tuticorin, Tenkasi and Kanniyakumari. A total of 120 samples (60 raw milk and 60 meat samples) were collected from sheep and goats at local markets, retail outlets and farms. Approximately 10 mL of milk was collected aseptically in sterile screw cap containers and 25 g of meat samples were collected in sterile polythene bags. All samples were transported under refrigerated conditions (4-8 °C) to the Veterinary Public Health -Zoonoses Research Laboratory, Veterinary College and Research Institute, Tirunelveli and were processed within 24 hours of collection.

Isolation and Identification of Staphylococcus aureus

Samples were enriched in brain heart infusion (BHI) broth supplemented with 7% NaCl and incubated overnight at 37 °C. Selective plating was performed on Baird Parker Agar (BPA) and incubated for 45-48 hours at 35-37 °C. Colonies showing typical morphology (jet black colonies with a clear halo) were presumptively identified as S. aureus. Confirmation was carried out by Gram staining, catalase test, tube coagulase test and HiStaph™ Test Kit (HiMedia, India).

Genomic DNA Extraction

Genomic DNA was extracted from presumptive isolates using the HiPurA™ Bacterial Genomic DNA Purification Kit (HiMedia, India). DNA concentration and purity were assessed using a Nanodrop spectrophotometer and extracts were stored at -40 °C until further use.

Molecular Confirmation of S. aureus

PCR assays were carried out using published primers (Table1). Species specific confirmation was performed by amplification of the nuc gene (Brakstad et al 1992) [3] and 16S rRNA gene (Fig 1) (Kohner et al 1999) [9] .

Detection of Methicillin Resistance

The presence of the mecA and femB genes was determined by PCR (Mohanasoundaram & Lalitha, 2008) [11] to confirm MRSA isolates (Fig 2 andFig 3)

Screening for Enterotoxin Genes

Multiplex PCR was employed to detect classical staphylococcal enterotoxin genes (sea, seb, sec, sed, see) following the method of Sharma et al 2000 [14] (Fig 4).

Results

Out of 120 samples (milk-60, meat-60) screened for the presence of Staphylococcus aureus spp. About 23 milk samples (60) and eight meat samples (60) were positive for Staphylococcus aureus by conventional culture and biochemical tests. Upon further characterization of the isolates by 16s rRNA and nucA gene PCR, all the 31 isolates were found to be positive. The overall prevalence of Staphylococcus aureus was only 25.83 percent in our study. of these S. aureus isolates 17 (54.83 %) were positive for both mecA and fem B genes. In the present study, the presence of five classical enterotoxin genes (sea, seb, sec, sed and see) were screened by Multiplex PCR and it was found that there was a prevalence of sea 6.45 % (2/31) and sed at 3.22 % (1/31) enterotoxin genes. CGA AAG CCT GAC GGA GCA AC AAC CTT GCG GTC GTA CTC CC 528bp Kohner et al. 1999 [9] 2. nuc A -F nuc A -R GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC 267 bp Brakstad et al. 1992 [3] 3. femB-F femB-R TTACAGAGTTAACTGTTACC ATACAAATCCAGCACGCTCT 651bp Mohanasoundram and Lalitha 2008 [11] 4.

mec A-F mec A-R GAAATGACTGAACGTCCGATAA CCAATTCCACATTGTTTCGGTCTAA 310 bp 5.

SA-U -Uni F TGTATGTATGGAGGTGTAAC

Sharma et al. 2000 [14] SEA

Discussion

In the present study an overall prevalence of 25.83% was observed. Similar studies in Tamil Nadu, wherein nasal swabs were collected from small ruminants like goats and sheep, depicted 28.57% prevalence (Rao et al 2023) [13] . This is slightly higher than our study report. Majority of the study focused only on bovine mastitis associated with S. aureus.

Another study in Bareilly, Uttar Pradesh analysed various samples viz., milk sample, nasal swabs and wound swabs from healthy animals viz., cattle, buffalo and pigs and observed about 17.73% prevalence in cattle followed by buffaloes (15.90%) and pigs (6.94%) (Das et al 2025) [5] . Another similar study in goat meat reported 46.2% prevalence, which is higher than our report (Dhruw et al 2025). Different prevalence has been reported in different studies throughout India. This difference might be contributed by multiple factors like farm management system, sampling methodology, sampling strategies, geographic location, hygienic practices during handling (Venugopal et al 2023). In the present study, milk from small ruminants showed higher prevalence of 38.3% than meat 13.3%. However, S. aureus is one among the predominant cause of subclinical mastitis, poor udder hygiene or contamination during milking may contribute to the increased prevalence in milk. In the present study about 17 isolates were found to carry mec A gene, depicting about 54.83% (17/31) prevalence. About half of the isolates (54.83%) were confirmed as MRSA by detection of mec A and fem B genes suggesting that small ruminant derived food may act as a potential reservoir for antibiotic resistant staphylococci. Another concern for MRSA transmission and development of antimicrobial resistance suggests poor farm sanitation and water management (Yam et al 2019) [20] . In the present study, the five classical enterotoxins (sea, seb, sec, sed and see) were screened by multiplex PCR. The distribution of enterotoxigenic S. aureus from food varies in many similar studies due to detection methods, source of food etc. Among the classical enterotoxins, sea and seb are associated with food explicitly linked to contamination of human origin whereas sec and sed are associated with contamination stemming from animals (Dhruw et al 2025 and Wu et al 2019) [6,19] . In addition, enterotoxins sea and sed have been implicated in various outbreaks of Staphylococcal food poisoning worldwide (Argudin et al 2010) [1] . In the present study, about 6.45% (2/31) isolates were found to carry sea and 3.22% (1/31) isolates carry sed suggesting contamination of human origin. Though lower prevalence has been recorded in our study, it highlights the potential food safety risk of enterotoxigenic S. aureus. Balaban and Rasooly (2000) in their study reported that sea as most common enterotoxin which can occur either alone or with other enterotoxins suggesting high resistance to proteolytic enzymes. Many epidemiological studies have highlighted the significance of staphylococcal enterotoxins in food, hence even at a low frequency, continuous monitoring is very important as ingestion of preformed toxin can itself cause illness irrespective of bacterial viability. This study emphasize the need for routine surveillance, strict hygienic practices during milking and slaughter. The results also support the One Health approach to ensure food safety.

Conclusion

This study is the first to document the prevalence of MRSA in milk and meat of small ruminants in southern Tamil Nadu. The overall prevalence of mecA gene was high among the Staphylococcus aureus isolates obtained confirming MRSA. The detection of enterotoxin genes, although at low frequency, highlights the potential food safety hazards associated with small ruminant products. These findings underline the urgent need for regular monitoring, improved hygienic practices, and rational antimicrobial use in livestock to mitigate the risk of transmission of resistant and toxigenic S. aureus to humans.

Acknowledgement

AcknowledgmentsThe author is grateful to the Dean, Veterinary College and Research Institute, Tirunelveli, for providing support and necessary facilities for conducting this research. The author also acknowledges the Tamil Nadu Veterinary and Animal Sciences University, Chennai, for providing necessary funding to work on this topic.

References

1. Argudin MA, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins. 2010;2(7):1751-1773.
2. Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol. 2000;61:1-10. doi:10.1016/S01681605(00)00377-9.
3. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol. 1992;30:1654-1660.
4. Department of Animal Husbandry and Dairying, Government of India. Annual report 2023-2024. Available from: DAHD official website
5. Das C, Rathore R, Singh VK. Prevalence, characterization and antibiogram of Staphylococcus aureus isolates from bovine and swine population in Bareilly, Uttar Pradesh, India. Sci Rep. 2025;15:28171. doi:10.1038/s41598-025-13369-6.
6. Dhruw R, Bhati T, Kumar S, Khandelwal S, Shringi BN. Multi-drug resistant enterotoxigenic Staphylococcus aureus in goat meat. J Livest Sci. 2025;16:606-613.
7. Huber H, Koller S, Giezendanner N, Stephan R, Zweifel C. Prevalence and characteristics of meticillinresistant Staphylococcus aureus in humans in contact with farm animals, in livestock, and in food of animal origin, Switzerland, 2009. Euro Surveill. 2010;15(16):19542.
8. Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and staphylococcal food-borne disease: an ongoing challenge in public health. Biomed Res Int. 2014;2014:827965.
9. Kohner P, Uhl J, Kolbert C, Persing D, Cockerill FR III. Comparison of susceptibility testing methods for oxacillin resistance in Staphylococcus aureus. J Clin Microbiol. 1999;37:2952-2961.
10. Lakhundi S, Zhang K. Methicillin-resistant Staphylococcus aureus: molecular characterization, evolution, and epidemiology. Clin Microbiol Rev. 2018;31(4):e00020-18. doi:10.1128/CMR.00020-18. International Journal of Agriculture and Food Science https://www.agriculturaljournals.com
11. Mohanasoundaram K, Lalitha M. Comparison of phenotypic versus genotypic methods in the detection of methicillin resistance in Staphylococcus aureus. Indian J Med Res. 2008;127:78-84.
12. Mostafa Abdalhamed A, Zeedan GSG, Ahmed Arafa A, Shafeek Ibrahim E, Sedky D, Abdel Nabey Hafez A. Detection of methicillin-resistant Staphylococcus aureus in clinical and subclinical mastitis in ruminants and studying the effect of novel green synthetized nanoparticles as one of the alternative treatments. Vet Med Int. 2022;2022:6309984. doi:10.1155/2022/6309984.
13. Rao RT, Madhavan V, Kumar P, Muniraj G, Sivakumar N, Kannan J. Epidemiology and zoonotic potential of livestock-associated Staphylococcus aureus isolated at Tamil Nadu, India. BMC Microbiol. 2023;23(1):326. doi:10.1186/s12866-023-03024-3.
14. Sharma NK, Rees CED, Dodd CER. Development of a single-reaction multiplex PCR toxin typing assay for Staphylococcus aureus. Appl Environ Microbiol. 2000;66:1347-1353.
15. Sharma VK, et al. Prevalence, antimicrobial resistance, and molecular characterization of MRSA in Indian dairy cattle. J Dairy Sci. 2018;101(5):4381-4390.
16. Venugopal N, Tewari R, Ganaie FA, Mitra S, Shome R, Shome BR. Prevalence and epidemiological characteristics of methicillin-resistant Staphylococcus aureus isolated from cattle in Bangalore, India as a part of the One Health approach. Access Microbiol. 2023;5(9):000627.v3. doi:10.1099/acmi.0.000627.v3.
17. Wang X, Li G, Xia X, Yang B, Xi M, Meng J. Antimicrobial susceptibility and molecular typing of methicillin-resistant Staphylococcus aureus in retail foods in Shaanxi, China. Foodborne Pathog Dis. 2014;11:281-286. doi:10.1089/fpd.2013.1643.
18. World Health Organization. Global action plan on antimicrobial resistance. Geneva: WHO; 2021. Available from: WHO foodborne disease estimates
19. Wu S, Huang J, Zhang F, Wu Q, Zhang J, Pang R, et al. Prevalence and characterization of food-related methicillin-resistant Staphylococcus aureus (MRSA) in China. Front Microbiol. 2019;10:304. doi:10.3389/fmicb.2019.00304.
20. Yam ELY, Hsu LY, Yap EPH, Yeo TW, Lee V, Schlundt J, et al. Antimicrobial resistance in the Asia Pacific region: a meeting report. Antimicrob Resist Infect Control. 2019;8:202. doi:10.1186/s13756-0190654-8.