Virulence gene profiling of avian pathogenic Escherichia coli serotypes of Kadaknath Chickens

Introduction

Colibacillosis caused by avian pathogenic Escherichia coli (APEC), is one of the most economically significant bacterial diseases affecting poultry worldwide. APEC strains are characterized by the presence of virulence associated genes (VAGs) that enable colonization, immune evasion and systemic infection in avian hosts. The virulence associated genes are typically found in large circular plasmids (50-200 kb) of pathogenic E. coli such as ColV and IncF plasmids (Johnson et al., 2006) [5] . Avian pathogenic Escherichia coli (APEC) employs a diverse array of virulence mechanisms that enable survival, colonization and systemic dissemination within the avian host these factors are VAGs, Key virulence factors include serum resistance (iss), adhesins (papC, tsh) and iron acquisition systems (iucC, sitA). Serum resistance is a critical determinant of pathogenicity, primarily mediated by the iss gene, which encodes an outer membrane lipoprotein that protects bacteria against complement mediated lysis and enhances bacterial persistence in host serum (Mellata et al. 2003) [9] . Adhesins such as P fimbriae, encoded by the papC gene, facilitate bacterial attachment to epithelial cells and are particularly associated with systemic infections as highlighted by Dziva and Stevens (2008) and Kathayat et al. (2021) [6] . The ability of APEC to colonize the respiratory tract is further enhanced by temperature-sensitive hemagglutinin (tsh), a multifunctional autotransporter protein exhibiting both adhesin and protease activities (Kwon et al. 2008) [8] . Studies by Dozois et al. (2000) [2] and Kobayashi et al. (2010) [7] have shown that tsh contributes to early-stage infection, mucosal colonization and lesion development in poultry. Siderophores such as aerobactin, encoded by the iuc ABCD/iut A locus and salmochelin, encoded by the iroBCDEN genes, play a crucial role in iron sequestration, thereby enhancing bacterial growth and virulence Caza et al. (2008) [1] . Virulence factors serve as molecular markers help in diagnosing and managing APEC infections. The detection of at least five VAGs is considered a reliable criterion for identifying APEC strains with enhanced virulence potential.

Materials and Methods

Genomic DNA extraction was performed using APEC isolates representing the prevalent serotypes identified in a prior study conducted in the department (Sharma et al., 2026) [12] . Pure E. coli cultures were grown overnight in BHI broth at 37°C. Bacterial cells were pelleted by centrifugation (10,000 × g, 3 min) and genomic DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer's protocol. DNA purity and concentration were assessed spectrophotometrically (A260/A280).

Virulence genes detection using PCR

Five VAGs viz iss, tsh, papC, iucC and sitA were targeted using published primer sequences and expected amplicon sizes are shown in Table 1. [15] iucC F: CGCCGTGGCTGGGGTAAG / R: CAGCCGGTTCACCAAGTATCACTG 541 Skyberg et al. (2003) [13] tsh F: GGTGGTGCACTGGAGTGG / R: AGTCCAGCGTGATAGTGG 642 Tivendale et al. (2004) [15] papC F: GTGGCAGTATGAGTAATGACCGTTA / R: ATATCCTTTCTGCAGGGATGCAATA 205 Johnson and Stell (2000) [4] sitA F: AGGGGGCACAACTGATTCTCG / R: TACCGGGCCGTTTTCTGTGC 608 Rodriguez-Siek et al. (2005) [10] PCR was performed in 25 µL reactions containing 12.5 µL Emerald Amp 2× PCR Master Mix, 0.5 µL each primer (10 µM), 2 µL template DNA, and nuclease-free water. Cycling conditions were presented in Table 2. Amplicons were resolved by electrophoresis on 1.5% agarose gels stained with ethidium bromide and visualized under UV transillumination.

Results

A total of 18 isolates representing the predominant serogroups O8, O78, O84, O7 and O115 were identified in earlier study as the most prevalent based on their frequency of occurrence (Sharma et al., 2026) [12] were subsequently selected as a representative subset for identification of VAGs. Gel electrophoresis following PCR amplification confirmed the expected product sizes for all five targeted VAGs iss (762 bp), tsh (642 bp), papC (205 bp), sitA (608 bp) and iucC (541 bp), as illustrated in Figures 12345.

The prevalence and distribution of the five virulence genes across the 18 screened isolates are summarized in Table 3. Four of the five genes iss, papC, iucC and sitA were detected in all 18 isolates (100%), indicating their universal presence across all five serogroups. The tsh gene, encoding a temperature-sensitive hemagglutinin protease, was detected in 16 of the 18 isolates (88.8%). It was present in serogroups O8, O78, O84, and O7, but was notably absent in the O115 serogroup. Consequently, isolates belonging to serogroup O115 harboured four of the five screened VAGs.

Discussion

The iss gene, encoding an outer membrane lipoprotein that confers serum resistance, was detected in 100% of isolates, consistent with its recognition as the most prevalent and reliable marker for APEC (Subedi et al. 2018) [14] . The ability to evade host serum bactericidal activity is critical for APEC survival in the bloodstream following translocation from the respiratory or gastrointestinal tract, and the ubiquitous carriage of iss in the present collection reinforces its pivotal role in systemic pathogenesis. Given its universal distribution, iss has been proposed as an indispensable component of any minimum gene panel intended for the molecular identification and classification of APEC (Ewers et al., 2004) [3] . Molecular characterization demonstrated that all five targeted VAGs were present in serotypes O8, O78, O7 and O84 indicating high pathogenic potential. The universal prevalence of papC, iucC, and sitA observed in this study further substantiates the central role of adhesion and iron acquisition systems in APEC pathogenicity. The papC gene encodes an outer membrane protein essential for the assembly of P fimbriae, which mediate adhesion to uroepithelial cells and respiratory mucosa, facilitating colonization and initial tissue invasion. The iucC gene, a component of the aerobactin siderophore biosynthesis cluster, enables APEC to chelate iron from the iron-limiting environment of host tissues, a prerequisite for sustained bacterial replication and the establishment of systemic infection (Dozois et al., 2003) [2] . Similarly, sitA, encoding the substrate-binding component of a ferrous iron and manganese transport system, provides an additional, complementary iron acquisition strategy that enhances APEC fitness in the host (Sabri et al., 2006) [11] . The cooccurrence of multiple iron uptake systems in the isolates from this study highlights the redundancy of iron acquisition mechanisms in APEC, a trait that confers a competitive survival advantage within the host microenvironment. The tsh gene, which encodes a temperature-sensitive hemagglutinin functioning as an autotransporter protease, was detected in all serogroups except O115 isolates. The tsh-encoded protein facilitates colonization of the respiratory mucosa by degrading mucus glycoproteins and immunoglobulins and its hemagglutinating activity has been proposed to promote initial attachment to host cells (Dozois et al., 2000) [2] . The absence of tsh in O115 isolates is a notable observation and suggests potential variability in early colonization mechanisms among APEC serogroups, possibly reflecting differences in the plasmid content or genomic island configurations of O115 strains compared to the predominant serogroups. This is consistent with earlier reports demonstrating that tsh is frequently carried on ColVtype plasmids and that its distribution is not uniformly conserved across all APEC lineages (Johnson et al., 2006; Skyberg et al., 2003) [5,13] .

In conclusion, the findings of the present study confirm the universal carriage of iss and the near complete distribution of the remaining four VAGs in the predominant serogroups underscore the pathogenic capacity of circulating APEC strains. These data support the implementation of a standardized five-gene molecular panel for routine APEC surveillance and provide a baseline for future epidemiological and comparative genomic investigations in indigenous poultry breeds. Continuous monitoring of APEC virulence profiles and antimicrobial resistance patterns in Kadaknath and allied breeds will be essential for informing disease management strategies and safeguarding both poultry health and public health at the human animal interface. These findings provide a molecular basis for surveillance and control of colibacillosis in indigenous poultry breeds and highlight the need for continued epidemiological monitoring to track emerging serotypes and virulence profiles.

References

1. Caza M, Lepine F, Milot S, Dozois CM. Specific roles of the iron BCDEN genes in virulence of an avian pathogenic Escherichia coli O78 strain and in production of salmochelins. Infection and Immunity. 2008;76(8):3539-3549.
2. Dozois CM, Dho-Moulin M, Brée A, Fairbrother JM, Desautels C, Curtiss R. Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the Tsh genetic region. Infection and Immunity. 2000;68(7):4145-4154.
3. Ewers C, Janssen T, Kiessling S, Philipp HC, Wieler LH. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction. Avian Diseases. 2005;49:269-273.
4. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. Journal of Infectious Diseases. 2000;181:261-272.
5. Johnson TJ, Johnson SJ, Nolan LK. Complete DNA sequence of a ColBM plasmid from avian pathogenic Escherichia coli suggests that it evolved from closely related ColV virulence plasmids. Journal of Bacteriology. 2006;188:5975-5983.
6. Kathayat D, Lokesh D, Ranjan R, Dhama K. Avian colibacillosis: Current understanding of pathogenomics, virulence factors, and control strategies. Veterinary Quarterly. 2021;41(1):64-92.
7. Kobayashi RK, Gaziri LC, Vidotto MC. Functional activities of the Tsh protein from avian pathogenic Escherichia coli (APEC) strains. Journal of Veterinary Science. 2010;11(4):315-319.
8. Kwon HM, Kim TE, Park MS, Lim TH, Kim JH, Lee HJ, et al. Prevalence of virulence-associated genes in avian pathogenic Escherichia coli isolates from chickens in Korea. Poultry Science. 2008;87(12):24922496.
9. Mellata M, Dho-Moulin M, Dozois CM, Curtiss R III, Lehoux B, Fairbrother JM. Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and in pathogenicity. Infection and Immunity. 2003;71(1):536-540.
10. Rodriguez-Siek KE, Giddings CW, Oetkott C, Johnson TJ, Nolan LK. Characterizing the APEC pathotype. Veterinary Research. 2005;36(3):241-256.
11. Sabri M, Leveillé S, Dozois CM. A Sit ABCD homologue from an avian pathogenic Escherichia coli strain mediates transport of iron and manganese and resistance to hydrogen peroxide. Microbiology. 2006;152:745-758.
12. Sharma P, Shrivastava N, Shukla S, Agrawal V, Gupta SK, Jadhav KK, et al. Prevalence and serological characterization of avian pathogenic E. coli in Kadaknath chicken: A comprehensive study. International Journal of Advanced Biochemistry Research. 2026;10(5):51-57.
13. Skyberg JA, Horne SM, Giddings CW, Wooley RE, Gibbs PS, Nolan LK. Characterizing avian Escherichia coli isolates with multiplex polymerase chain reaction. Avian Diseases. 2003;47:1441-1448.
14. Subedi M, Luitel H, Devkota B, Bhattarai RK, Phuyal S, Panthi P, et al. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Veterinary Research. 2018;14:113-118.
15. Tivendale KA, Allen JL, Ginns CA, Crabb BS, Browning GF. Association of iss and iucA but not tsh, with plasmid-mediated virulence of avian pathogenic Escherichia coli. Infection and Immunity. 2004;72:6554-6560.