Investigating the beneficial effects of co-culturing buffalo embryos with oviductal exosomes by evaluating the candidate transcripts of embryo conditioned medium

Introduction

In the in vitro embryo production system, embryos totally miss out on the early oviductal life as the oviduct nurtures the conditions required for sperm capacitation, transport, and fertilisation of the matured oocyte until early embryonic development. Additionally, the epigenetic modification that modulates the embryo development and further implantation also happens while the embryo resides in the oviduct. At the molecular level, embryonic genome activation (EGA) to overcome the developmental arrest at the 8-16 cell stage, also takes place while it is in the oviduct (Graf et al. 2014) [7] . Thus, the provision of an oviductal like environment is the missing link during in vitro embryo production making the outcome inferior to the in vivo physiological system. Several in vitro models have been suggested to mimic the oviductal environment, which includes co-culture with oviductal epithelial cells (OECs) (Cordova et al. 2014) [4] and the use of oviductal fluid (OF) (Lopera-Vasquez et al. 2016) [15,17] . The methodological complexity, associated bio-sanitary risks, and lack of reproducibility associated with using OECs and OF demand an alternative model. Beyond understanding traditional cell-to-cell communication, recent researches invited attention to the membrane-limited nanovesicles secreted by cells, called extracellular vesicles (EVs). By transferring the biomolecule(s) it carries (mRNA, miRNA, and proteins), EVs modulate the activities of recipient cells by participating in active intercellular communication, playing a key role in the regulation of important physiological and pathological processes (Ni et al. 2020) [24] .

Oviductal exosomes can be a potential substitute for OECs and OF for in vitro embryo co-culture systems and can be derived from both sources. Studies by Lopera-Vasquez et al. (2016) [15,17] evidenced that, exosomes derived from the OEC-conditioned medium improved the quality of bovine blastocysts produced in vitro, to the same extent as done with OEC monolayers. The effect of exosome supplementation on the development and quality of in vitro produced embryos can be assessed in different ways. Invasive methods like differential staining of embryos can be attempted to evaluate embryo development based on the number of cells of the inner cell mass (ICM) and the trophectoderm (TE) and for the viability of embryos (Thouas et al. 2000) [27] . A widely used non-invasive method to assess embryo development and quality is by assessing the embryo secretome of the conditioned medium. It is advantageous over the morphological selection of embryos which is strongly influenced by inter-observer variations and is associated with lower accuracy. Advances in omics technologies have enabled the application of new molecular methods for investigation into their transcriptomic and proteomic content of the embryo conditioned medium. Earlier researches reported that oviductal EV supplementation to embryo culture medium has an impact on gene expression (Lonergan et al. 2006) [14] , miRNA transcriptome (Kropp et al. 2014) [12] and proteome (Banliat et al. 2022) [3] , consequently determining embryo quality. With the above background knowledge, the proposed study evaluated the differential expression of candidate RNAs (mRNAs and miRNAs) during in vitro culture of buffalo embryos when cultured alone and in the presence of oviductal exosomes.

Materials and Methods

To evaluate the potential benefits of oviductal exosomes, buffalo embryos were produced in the presence and absence of oviductal exosomes in vitro. The exosomes supplemented in the study were earlier isolated from OEC culture conditioned medium and was characterised following MISEV (minimum standard for extracellular vesicles) recommendations (Naheef et al. 2024b) [22,23] . On Day 6 post-fertilization, the developmental status of the embryos was examined under a stereo zoom microscope, and the embryos were removed from the culture wells in a minimal amount of medium. The remaining embryo-conditioned medium (ECM) was harvested and utilized for molecular evaluation of candidate mRNAs and miRNAs. An equal number of exosomes that are supplemented in the exosome co-culture group was added to the ECM collected from the control group (embryo culture without oviductal supplementation) to nullify the effect of molecular cargo provided by oviductal exosomes. [11] 2 bta-miR-191 CAACGGAATCCCAAAAGCAGCTG Kropp and Khatib, 2015 [11] 3 bta-miR-184 TGGACGGAGAACTGATAAGGGT Mellisho et al. 2019 [19] 2.1 Expression profiling of candidate mRNAs in the ECM Total RNA was isolated from all the biological replicates of the ECM, following the Trizol (RNAiso Plus, Takara) based protocol. Immediately after extraction and quantification, the purified RNA was reverse transcribed to cDNA using PrimeScript RT reagent kit (Takara). Quantitative Real-time PCR (qRT-PCR) was performed to quantify the expressed mRNA levels for the selected genes (GPX1, SCD, CX43 and BCl2). All the qPCR reactions were performed using TB Green Premix ExTaq (Takara). The annealing temperatures used were: 60 °C for GPX1 and SCD; 56 °C for CX43 and 62 °C for BCl2. Primers with the published sequence as mentioned under Table 1 were used for amplification. Relative expression levels of each gene studied under exosome treated and control group were quantified by the comparative cycle threshold method (ΔΔC T ) method. Values were normalised using H2AFZ (Histone) as housekeeping gene. The normalised values were subjected to statistical analysis and the means were compared by unpaired t-test using GraphPad Prism 9.5.1 at 1% level of significance.

Expression profiling of candidate miRNAs in the ECM

Component miRNA transcript was isolated from the conditioned medium of each biological replicate using NucleoSpin miRNA isolation kit (Macherrey Nagel) and reverse transcription was achieved using the miRNA first strand synthesis kit (Takara). The expression levels of candidate miRNAs were quantified using TB Green Advantage qPCR mix (Takara) in the CF-96 qPCR detection system (BioRad). As per the manufacturer guidelines, the expression level of each miRNA was determined relative to the level of U6snRNA. The qPCR protocol used designed 5' primers specific for different miRNAs of interest (Table 2) and a universal 3' primer provided by the manufacturer. [4] H2AFZ AGGACGACTAGCCATGGACGTG CCACCACCAGCAATTGTAGCCG 208 bp Lopera-Vasquez et al. 2017 [16]

International Journal of Advanced Biochemistry Research https://www.biochemjournal.com

A real time PCR reaction for U6snRNA was separately performed for each cDNA sample analysed. The qPCR was performed for each sample in duplicates, and the 2 -ΔΔCt method was used to analyse the data, as done for the relative mRNA expression described earlier.

Bioinformatics analysis of the differentially expressed miRNAs

For the identification of biological pathways, bioinformatics analysis of the identified miRNAs that were differentially expressed between the treatment and control groups was carried out. The targets of miRNAs were predicted using TargetScanHuman v 8.0 and miRWalk following default parameters. For downstream analysis, target genes predicted by TargetScanHuman v 8.0 were used. The predicted target genes were subjected to gene ontology and pathway mapping using DAVID. The GO terms and pathways were sorted on fold enrichment values. The analysis was conducted with a default EASE score of 0.1 to include most terms.

Results

To support the findings that supplementing oviductal exosomes during in vitro embryo culture improved the developmental rate and viability of buffalo embryos, molecular investigation into the differential expression of candidate mRNAs and miRNA transcripts in the ECM was carried out.

Differential expression profiling of candidate mRNAs in the ECM

The relative expression levels of selected gene transcripts that were already been proven to have a crucial role in embryo development and quality were analysed by qRT-PCR. The genes selected in the study were: CX43 (related to compaction and cell-cell adhesion), SCD (involved in lipid metabolism), GPX1 (involved in protection against oxidative stress/ROS), and BCl2 (anti-apoptotic transcripts). Histone gene (H2AFZ) was taken as the housekeeping gene in the study.

Relative expression of the genes between the exosome treated and control group was represented as fold change, using 2 -ΔΔCt method. It was found that all the candidate genes studied were upregulated in the conditioned media transcriptome of embryos produced in the presence of oviductal exosomes. The relative abundance of each gene was statistically analysed by unpaired t-test and the results are represented in Figure 1. The fold change in expression (given in brackets for each candidate gene) was: CX43 (39.06), GPX1 (17.10), SCD (12.74), and BCl2 (8.70). All the results were statistically significant (p < 0.01).

Differential expression profiling of candidate miRNAs in the ECM

Among a large number of miRNAs cited as crucial for embryo development, three important miRNAs differentially expressed between exosome-treated and control group embryo-conditioned medium were statistically validated by real-time PCR. The miRNAs selected in the study were: bta-miR-24-3p, bta-miR-191, and bta-miR-184. Alongside, U6snRNA was chosen as the internal reference. The fold change in expression for each of these miRNA transcripts studied under the exosome-treated and control group evaluated by 2 -ΔΔCt method is presented in Figure 2. Real-time PCR analysis revealed that both miR-24-3p (9.45fold) and miR-191 (8.05-fold) were downregulated when exosomes were supplemented during in vitro embryo culture. The expression of miR-184 was found to be upregulated by 13.19-fold in the presence of oviductal exosomes in the culture. The fold change in the relative abundance of the transcripts studied was analysed by unpaired t-test and was statistically significant (p < 0.01).

Bioinformatics analysis of the candidate miRNAs

Functional analysis of the candidate miRNA target genes was carried out to identify the associated signalling/biological pathways. Among a large number of pathways identified for each miRNA, a few were selected based on their importance in the study and based on fold enrichment of the genes. It was observed that pathways predicted for miR-24-3p included cytosolic transport, DNA repair, and regulation of prime metabolic processes, among many illustrated in Figure 3. The list of important pathways identified to be regulated by miR-191 included regulation of cellular process, developmental process and cell morphogenesis as indicated in Figure 4. The important pathways identified revealed that miR-184 is involved in regulation of gene expression, cellular metabolic and molecular processes, other biological events as represented in Figure 5. All the selected biological/signalling pathways and their functional clusters were found to be statistically significant (p < 0.05).

Discussion

With motives from previous reports in bovines, other domestic species, and humans, we have reported that embryo developmental rate and viability rate improved significantly when co-cultured with oviductal exosomes in vitro (Naheef et al. 2024a) [22,23] . The present study attempted to correlate the data of microscopic evaluation with molecular evidence at transcriptomic (mRNA and miRNA) levels by investigating the conditioned media collected when embryos reached the morula/early blastocyst (EB) stage. To the best of our knowledge, this is the first study to validate the relative abundance of transcripts (mRNAs and miRNAs) upon supplementing oviductal exosomes during in vitro production of buffalo embryos.

Differential expression profiling of candidate mRNAs in the ECM

Even with an extensive investigation on the expression levels of several important genes, to date, consensus could not be attained in finalising the genes that would be potential markers for embryo development/quality. The genes transcripts selected in the study namely CX43, SCD, GPX1, and BCl2 are related directly to embryo development and quality. Connexin 43 (CX43) plays a crucial role in embryo compaction and cell-to-cell adhesion. This study reported an upregulation of the CX43 transcripts up to 39.06-fold in the exosome-supplemented group as depicted in Figure 1. A similar finding was reported by Lopera Vasquez et al.

(2016) [15,17] , who studied the expression of CX43 upon oEV (oviductal extracellular vesicle) supplementation during in vitro production of bovine embryos. Further support to the findings was provided by Cordova et al. (2014) [4] , who evidenced an upregulation of CX43 transcripts while bovine embryos were co-cultured with OEC monolayers in vitro.

The upregulation of this particular gene is well documented in many in vitro studies, as it is expressed throughout the 8-16 cell stage of embryo development, both under in vitro and in vivo conditions (Lonergan et al. 2003) [13] in bovines. Also, a higher expression of CX43 is generally associated with the presence of better-quality embryos having improved ability to tolerate cryopreservation and subsequent thawing as quoted by Gutierrez-Adan et al. (2004) [8] . GPX1 is well understood for its role in fighting against oxidative stress and ROS-mediated developmental arrest of embryos. The present study revealed an increased expression level of GPX1 transcripts upon providing oviductal exosomes during in vitro embryo development.

Similarly, Lopera Vasquez et al. (2016) [15,17] reported an upregulation of GPX1 gene upon utilizing the BOECderived exosomes for bovine embryo development.

Functionally, GPX1 is related to free radical scavenging and contributes to mitigation of oxidative stress (Sidrat et al. 2020) [26] . Thus, upregulation in GPX1 transcripts reflects the positive effect of exosome on embryo development by way of modifying the culture environment. Another possible explanation provided by Melka et al. (2010) [18] is that OECs evade apoptosis of blastocysts through downregulation of TP53, a pro-apoptotic gene and that GPX1 gene is under the control of TP53. SCD gene codes for primary enzymes involved in lipid metabolism. It can be inferred from Figure 1 that, SCD transcripts were upregulated in the conditioned medium of embryos produced by oviductal exosome-based co-culture system. This is in accordance with the reports of Cordova et al. (2014) [4] who evaluated the merits on in vitro embryo development with the provision of BOEC monolayers during various stages of embryo development. Al Darwich et al. (2010) [2] were able to correlate the increased expression of SCD gene in in vivo system with culture of embryos in sheep oviduct. He reported that GPX1 expression was higher in pure in vivo system, compared to embryos co-cultured with BOEC in vitro. This gene is also reported to improve survival rate of embryos upon cryopreservation and thawing, as the higher lipid content in trophectoderm (TE) cells renders them more susceptible to damage during cryopreservation. As the oviductal epithelium is actively involved in lipid metabolism, these functions are thought to be mimicked by in vitro cultured BOECs (Cordova et al. 2014) [4] , and in turn its component exosomes. Although there are no earlier reports of using oEVs as such to validate its potential role during in vitro embryo development, all this scientific information positively correlates with the outcome of the current study. Being a proven antiapoptotic gene, the transcripts of BCl2 were selected in the study, to evaluate the beneficial effects of oviductal exosomes during in vitro embryo development.

As shown in Figure 1, BCl2 transcripts were more abundant in the conditioned medium when embryos were co-cultured with oviductal exosomes. With OF based coculture system, Qu et al. (2019) [25] have evaluated the functional importance of BCl2 (along with the proapoptotic gene Bax), in deciding the fate of in vitro produced embryos. They reported an upregulation of BCl2 and corresponding downregulation of Bax gene. Also, a ratio of the relative expression of BCl2 to Bax is supposed to give a better understanding of the survivability of embryos. Later, Fang et al. (2022) [6] in their study on porcine embryonic development with OEC-derived EVs provided supporting results with an upregulation of BCl2 during early embryonic development in vitro. Being a functional cargo, the functional effects brought about by the OEC/OF is supposed to be conserved with its constituent exosomes, producing the same effect.

Differential expression profiling of candidate miRNAs in the ECM

Micro RNAs (miRNAs) are the non-coding RNAs that modify biological processes either negatively by hindering translational repression or positively by targeting specific gene promoters. Aiming towards finding a miRNA-based non-invasive biomarker for embryo selection, the relative expression levels of three selected miRNAs (miR-24-3p, miR-191 and miR-184) were investigated in this study.

U6snRNA was selected as the housekeeping gene in the study, as it was previously shown to be stably expressed in various developmental stages of bovine embryos (Abd El Naby et al. 2013) [1] .

In the present study, as represented in Figure 2, it could be seen that miR-24-3p transcripts were found to be downregulated when oviductal exosomes were supplemented during their in vitro development. Earlier studies of Kropp and Khatib (2015) [11] evidenced a reduction in the expression of miR-24-3p transcripts in the conditioned medium of in vitro produced good quality bovine blastocysts, wherein an upregulation of miR-24-3p was observed up to morula stage and downregulation was noticed thereafter. Further, by supplementing miR-24 mimic in the embryo culture medium, they were successful in relating its increased expression with the presence of degenerated embryos. Thus, it is evident that downregulation of miR-24-3p is correlated to good quality, progressively developing embryos. The mechanism of action of this miRNA, is attributable to: (i) downregulation of dihydrofolate reductase, the S-phase enzyme involved in regulation of cell cycle (Mishra et al. 2009) [20] , and (ii) repressed expression of its target gene, CDKN1b, a cell cycle inhibitor (Kropp et al. 2014) [12] . Further, Kasper et al. (2017) [9] were able to correlate the down regulation of miR-24-3p with stress, experienced during in vitro culture of embryos.

In the present study, evaluation of miR-191 expression was also resulted to be downregulated when the embryos were co-cultured with oviductal exosomes, as represented in Figure 2. Kropp and Khatib (2015) [11] positively related miR-191 expression with degenerated and aneuploid bovine embryos. Supporting the findings of the present study further, Weber et al. (2010) [28] reported a higher expression of miR-191 under stressful conditions of human embryo development. Additionally, they found a relatively higher miR-191 expression in the medium of embryos fertilised by ICSI (intracytoplasmic sperm injection), possibly due to the physical damage produced to zona and oolemma during the procedure. In this study, miR-184 was found upregulated when embryos were cultured with oviductal exosomes. This particular miRNA has not been much studied so far for their expression in bovine/human embryos. To date, there are no direct reports correlating the provision of oEVs (or its source of origin) and the resulting increment in the expression of miR-184. However, circumstantial evidence is provided by Mellisho et al. (2019) [19] who reported an upregulation of miR-184 in viable bovine embryos, compared to non-viable ones. Similarly, the observations of low levels of miR-184 in maternal blood and associated early pregnancy loss in cattle embryos have been documented by De Bem et al. (2017) [5] . Reports of Zhang et al. (2019) [29] on the involvement of miR-184 in embryo resorption in mice and humans, also add on to our finding that miR-184 is upregulated in progressively developing embryos.

Bioinformatics analysis of the candidate miRNAs

Evaluation of the miRNAs using bioinformatics tools is valuable to identify their potential role in regulating biological processes or cell signalling. To gain insight into the regulatory role of the three miRNAs investigated in this study, relevant pathways and their target genes were predicted, as represented in Figures, 3-5. A detailed list was provided as Annexure. The Wnt and TGFβ cascades were the most prominent among the signalling pathways predicted for these three miRNAs studied. These pathways were reported to have importance in the regulation of biological events essential for the establishment and maintenance of pregnancy. Particularly, Wnt signalling is conserved within the mammalian species, and it regulates various events in embryonic development including the determination of cell fate, motility, polarity, and organogenesis (Komiya and Habas, 2008) [10] . In mammals, TGFβ ligands are also known to be important in the establishment and maintenance of early embryonic development and pregnancy (Monsivais et al. 2017) [21] .

Conclusion

To evaluate the quality influence of oviductal exosomes during in vitro production of buffalo embryos and to go further towards choosing a non-invasive biomarker for embryo quality, analysis of candidate mRNA and miRNA transcripts of the embryo-conditioned medium (ECM) was performed. A higher expression was achieved for all the studied genes (CX43, SCD, GPX1, and BCl2) when exosomes were supplemented during embryo culture, indicative of the creation of a favourable new environment for in vitro development. Of the miRNAs studied, miR-24-3p and miR-191 were found to be downregulated at morula/EB stage when oviductal exosomes were supplemented during embryo culture. Another marker for embryo viability, miR-184, was found to be upregulated in the exosome co-cultured group. Thus, the results of mRNA and miRNA expression analysis supported the positive role played by oviductal exosomes during embryo development. Further bioinformatics analysis of the candidate miRNAs predicted the possible biological pathways, supporting the findings of this study.

Author Contributions

This work is a part of Ph.D thesis of Naheef, K. The work is carried out at Department of Animal Biotechnology, Madras Veterinary College, Tamil Nadu Veterinary and Animal Sciences University, India under the guidance of K. Brindha, TMA Senthil Kumar, PSL Sesh, S Rangasamy and M Parthiban. VN Muhasin Asaf has contributed in the bioinformatics analysis performed in this work. All authors have read and agreed to publish the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Data availability statement

The data that supports the findings of this study are available from the first author upon reasonable request.

References

1. Abd El Naby WS, Hagos TH, Hossain MM, SalilewWondim D, Gad AY, Rings F, et al. Expression analysis of regulatory microRNAs in bovine cumulusoocyte complex and preimplantation embryos. Zygote. 2013;21(1):31-51.
2. Al Darwic A, Perreau C, Petit MH, Papillier P, Dupont J, Guillaume D. Effect of PUFA on embryo cryoresistance, gene expression and AMPK-alpha phosphorylation in IVF-derived bovine embryos. Prostaglandins Other Lipid Mediat. 2010;93:30-36.
3. Banliat C, Mahe C, Lavigne R, Com E, Pineau C, Labas V, et al. Proteomic analysis of bovine embryos developed in vivo or in vitro reveals the contribution of the maternal environment to early embryo development. BMC Genomics. 2022;23:839.
4. Cordova A, Perreau C, Uzbekova S, Ponsart C, Locatelli Y, Mermillod P. Development rate and gene expression of IVP bovine embryos co-cultured with bovine oviduct epithelial cells at early or late stage of preimplantation development. Theriogenology. 2014;81:1163-1173.
5. De Bem THC, da Silveira JC, Sampaio RV. Low levels of exosomal miRNAs in maternal blood are associated with early pregnancy loss in cloned cattle. Sci Rep. 2017;7:14319.
6. Fang X, Tanga BM, Bang S, Seong G, Saadeldin IM, Lee S, et al. Oviduct epithelial cells-derived extracellular vesicles improve preimplantation developmental competence of in vitro-produced porcine parthenogenetic and cloned embryos. Mol Reprod Dev. 2022;89(1):54-65.
7. Graf A, Krebs S, Heininen-Brown M, Zakhartchenko V, Blum H, Wolf E. Genome activation in bovine embryos: review of the literature and new insights from RNA sequencing experiments. Anim Reprod Sci. 2014;149:46-58.
8. Gutierrez-Adan A, Rizos D, Fair T, Moreira PN, Pintado B, de la Fuente J, et al. Effect of speed of development on mRNA expression pattern in early bovine embryos cultured in vivo or in vitro. Mol Reprod Dev. 2004;68:441-448.
9. Kasper DM, Moro A, Ristori E, Narayanan A, HillTeran G, Fleming E, et al. MicroRNAs establish uniform traits during the architecture of vertebrate embryos. Dev Cell. 2017;40:552-565.
10. Komiya Y, Habas R. Wnt signal transduction pathways. Organogenesis. 2008;4:68-75.
11. Kropp J, Khatib H. Characterization of microRNA in bovine in vitro culture medium associated with embryo quality and development. J Dairy Sci. 2015;98:65526563.
12. Kropp J, Salih SM, Khatib H. Expression of microRNAs in bovine and human preimplantation embryo culture medium. Front Genet. 2014;5:91.
13. Lonergan P, Rizos D, Gutierrez-Adan A, Moreira PM, Pintado B, de la Fuente J, et al. Temporal divergence in International Journal of Advanced Biochemistry Research https://www.biochemjournal.com the pattern of messenger RNA expression in bovine embryos cultured from the zygote to blastocyst stage in vitro or in vivo. Biol Reprod. 2003;69:1424-1431.
14. Lonergan P, Fair T, Corcoran D, Evans AC. Effect of culture environment on gene expression and developmental characteristics in IVF-derived embryos. Theriogenology. 2006;65:137-152.
15. Lopera-Vasquez R, Hamdi M, Fernandez-Fuertes B, Maillo V, Beltran-Brena P, Calle A, et al. Extracellular vesicles from BOEC in in vitro embryo development and quality. PLoS One. 2016;11:e0148083.
16. Lopera-Vasquez R, Hamdi M, Maillo V, GutierrezAdan A, Bermejo-Alvarez P, Ramirez MA, et al. Effect of bovine oviductal extracellular vesicles on embryo development and quality in vitro. Reproduction. 2017;153:461-470.
17. Lopera-Vasquez R, Hamdi M, Maillo V, Nunez C, Yanez-Mo M, Ramirez MA, et al. Extracellular vesicles of bovine oviductal fluid modify the gene expression on bovine in vitro-derived embryos. Reprod Fertil Dev. 2016;28:179-179.
18. Melka MG, Rings F, Holker M, Tholen E, Havlicek V, Besenfelder U. Expression of apoptosis regulatory genes and incidence of apoptosis in different morphological quality groups of in vitro-produced bovine preimplantation embryos. Reprod Domest Anim. 2010;45:915-921.
19. Mellisho E, Briones M, Velasquez AE, Cabezas J, Castro FO, Rodriguez-Alvarez L. Extracellular vesicles secreted during blastulation show viability of bovine embryos. Reproduction. 2019;158(6):477-492.
20. Mishra PJ, Son B, Wan Y, Humeniuk R, Banerjee D, Merlin G, et al. miR-24 tumor suppressor activity is regulated independent of p53 and through a target site polymorphism. PLoS One. 2009;4:e8445.
21. Monsivais D, Matzuk MM, Pangas SA. The TGF-beta family in the reproductive tract. Cold Spring Harb Perspect Biol. 2017;13:a022251.
22. Naheef K, Brindha K, Senthil Kumar TMA, Sesh PSL. Co-culture of buffalo embryos with oviductal exosomes in vitro. Indian Vet J. 2024;100(12):50-54.
23. Naheef K, Brindha K, Senthil Kumar TMA, Sesh PSL, Parthiban M, Rangasamy S. Isolation and characterisation of exosomes derived from buffalo oviductal epithelial cells. Indian J Anim Sci. 2024;94(9):770-773.
24. Ni Z, Zhou S, Li S, Kuang L, Chen H, Luo X. Exosomes: roles and therapeutic potential in osteoarthritis. Bone Res. 2020;8(1):25.
25. Qu P, Zhao Y, Wang R, Zhang Y, Li L, Fan J, et al. Extracellular vesicles derived from donor oviduct fluid improved birth rates after embryo transfer in mice. Reprod Fertil Dev. 2019;31(2):324-332.
26. Sidrat T, Khan AA, Joo M, Wei Y, Lee K, Xu L, et al. Bovine oviduct epithelial cell-derived culture media and exosomes improve mitochondrial health by restoring metabolic flux during preimplantation development. Int J Mol Sci. 2020;21:7589.
27. Thouas GA, Korfiatis NA, French AJ, Jones GM, Trounson AO. Simplified technique for differential staining of inner cell mass and trophectoderm cells of mouse and bovine blastocysts. Reprod Biomed Online. 2000;3(1):25-29.
28. Weber M, Baker MB, Moore JP, Searles CD. miR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity. Biochem Biophys Res Commun. 2010;393:643-648.
29. Zhang Q, Higginbotham JN, Jeppesen DK, Yang YP, Li W, McKinley ET, et al. Transfer of functional cargo in exomeres. Cell Rep. 2019;27:940-954.