Molecular detection of some intestinal protozoa isolation from farm soil

Introduction

Single-celled eukaryotic microorganisms are intestinal protozoan parasites. The fecal-oral pathway is the means by which intestinal protozoa are spread. As a result, they mostly impact underprivileged groups, particularly children, who lack access to safe water, better sanitation, and proper hygiene (Paul, 2024) [14] . According to Ghazy et al. (2025) [8] , these infections may be asymptomatic or result in diarrhoea, malnourishment, stomach discomfort, and stunted growth and development. Soil-transmitted parasites constitute the biggest category of parasites, encompassing intestinal protozoa that inhabit the soil during their developmental stages (Blackburn et al., 2024) [3] . Soil contamination with cysts and oocysts represents the primary risk factor for zoonotic parasite infections (Kihara et al., 2025) [9] . According to Zeng et al., (2024) [22] , the estimated worldwide burden of enteric protozoa in 2010 was nearly 3 million Disability Adjusted Life Years. However, these are approximations based on national and regional statistics that are lacking. Furthermore, sensitive molecular diagnostic methods have not been employed in the majority of surveillance investigations (Mejia et al., 2024) [11] . As of now, there has been no study on soil protozoan networks, and elucidating the "dark box" of connections within the soil food web continues to pose a significant problem in soil biology. Pathogenic protozoa can contaminate soil via the faeces of sick humans and animals (Rossi et al., 2024) [17] . Protozoans are able to launch infectious stages in the form of oocysts and cysts, which are released into the environment by the feces of sick hosts and are resistant to disinfectants and other environmental agents. As a result, they may endure for extended periods of time under a variety of circumstances and are extensively present in the environment, water, and food. The World Health Organisation (WHO) identified several protozoan parasites that are frequently spread through tainted food and water, including Giardia intestinalis, Entamoeba histolytica and Cryptosporidium spp., as serious public health concerns in 1987 because they primarily affect children in developing nations and cause malabsorption (Marhoon and Al-Aredhi, 2025) [10] .

These microorganisms cause IPI (intestinal parasites infections) which inhibits children's growth due to chronic diarrhea (Namkuna, 2024) [13] . The purpose of this study is to use molecular and microscopic detection to examine the prevalence of certain intestinal diseases that have been isolated from the soil of Hilla City, Iraq.

Materials and Methods

Collection of Samples 200 farm soil samples were taken at different Babylonian locations between April 2024 and April 2025 using the procedures outlined below. Five-gram soil samples from farms are put into sterilized acrylic containers with the label "area date". They then travel to the Department of Parasitology at Al-Qasim Green Uni. College of Vet. Med. for molecular examinations.

Laboratory Examination DNA extraction

In accordance with the manufacturer's instructions, DNA was extracted using the fecal lysis method with proteinase K (DNA extraction kit, Korea, Bioneer). Before being used in PCR amplification, the extracted genomic DNA (gDNA) was measured using a NanoDrop spectrophotometer (Thermo, United States) and kept at -20 °C. (Alseady and Kawan, 2019) [2] .

Molecular diagnosis of Giardia intestinalis and Cryptosporidium spp by using Nested PCR (nPCR)

In order to isolate Cryptosporidium spp. from cow faecal samples, the nested PCR method was based on the 18S ribosomal rRNA gene. Procedure by Paul et al. (2009) were the faecal samples subjected to DNA extraction using an AccuPrep® stool DNA Extraction Kit (Bioneer, Korea). The forward (5-AGACGGTAGGGTATTGGCCT-3) and reverse (5-TACGAATGCCCCCAACTGTC-3) primer pairs from a MaximeTM PCR PreMix Kit (i-Taq) were used to prepare the primary PCR master mixes, which were then put into a PCR thermocycler (MyGene, Bioneer, Korea). The same procedure was used to prepare the secondary PCR master mix (forward, 5-ATTGGAGGGCAAGTCTGGTG -3; and reverse, 5-TACGAATGCCCCCAACTGTC; -3), but they were placed in separate MyGene PCR thermocyclers (Bioneer, Korea). For Giardia intestinalis, the exact same first PCR master mix was completed using the forward (5'-CCAA GAAGGCTAAGCGTGC-3' and reverse (5'-GGTCAAGAGCTTACAACACG-3' Insert primer pairs from a MaximeTM PCR PreMix Kit (i-Taq) and placed into a PCR Thermocycler (MyGene, Bioneer, Korea). The secondary PCR master mix was taken from the forward (5'-GCACAGAACGTGTATCTGG-3' and reverse (5'-CTCTGCTCATTGGTCTCGC-3') inserts from a Maxime TM PCR PreMix Kit (i-Taq) in the same way using a MyGene PCR Thermocycler (Bioneer, Korea).

Molecular diagnosis Entamoeba spp

We used particular primers for Entamoeba species in our PCR experiment. The National Center for Biotechnology Information (NCBI) established national guidelines, which were followed in the construction of the 18S rRNA gene primers. Next, the Entamoeba spp. RL2 partial 18S rRNA gene (GenBank: FR: 686362.1) was sequenced and used online using primers 3 plus (Bioneer) and the NCBI GenBank database for determination. 590 bp of the 18S rRNA gene were amplified using the primers 18S rRNA-F (ATTGGAGGGCAAGTCTGGTG) and 18S rRNA-R (CATACTCCC CCTGAAGTCCA). Consequently, the Bioneer AccuPower ® PCR Premix Kit was incorporated in the PCR mix (EL-Hamid et al., 2021) [6] .

Statistical Analysis

Microsoft Excel 2010 and the Statistical Package for Social Science (SPSS) for Windows program version 27 were used for statistical analysis. Using the chi-square test, the differences between the groups were assessed. P-values less than 0.05 were utilized as the significance level in all statistical analyses (Zhao et al., 2022) [23] .

Results

The Table 1, presents the molecular detection results of intestinal protozoa in a total of 200 agricultural soil samples. Giardia intestinalis was the most frequently detected parasite, identified in 71 samples (35.5% of the total samples). Cryptosporidium spp. were detected in 63 samples (31.5%), reflecting their strong environmental resistance. Entamoeba histolytica showed the lowest prevalence, with 46 positive samples (23%). Overall, these results demonstrate that molecular techniques provide a more sensitive assessment of protozoan contamination in agricultural soils.

Nested PCR

Farm soil samples were used to identify G. intestinalis assemblages using amplified gene products from nested PCR using primers targeting the tpi gene. Agarose gel electrophoresis was used for verification. Figure 1 shows a single 535 bp band for G. intestinalis assemblage A, while Figure 2 shows a single 470 bp band for G. intestinalis assemblage B.

Phylogenetic analysis Entamoeba histolytica

Five sequences each belonging Entamoeba histolytica Phylogenetic analysis sequences each belonging (PX247889, PX247890, PX247891, PX247892 and PX247893). The phylogenetic tree revealed the identity between the isolates of Entamoeba histolytica. The isolates were similar to (accession No ON724165.1) and (accession No. OM268856) for Entamoeba dispar as highlighted in Figures-9.

Discussion

The present study provides molecular evidence of widespread contamination of agricultural soils with intestinal protozoa, highlighting the potential public health risks associated with soil-human transmission routes. Using sensitive PCR-based methods, Giardia intestinalis was identified as the most prevalent protozoan, followed by Cryptosporidium spp.

Entamoeba histolytica appears to be a parasite found in environmental samples and has been shown to have low levels of detection with traditional visual methods, whereas molecular diagnostic tests are capable of identifying low levels of parasitic organisms as well as any non-viable stages of the parasite that traditional microscopy cannot detect. The high rate of detection (35.5%) of G. intestinalis in soil samples validates the well-studied ability of the parasite to persist in the environment and its potential to affect both humans and animals through zoonotic routes. Cysts of Giardia spp. may remain dormant in moist soil for several months or more and are widespread in agricultural areas due to the potential for contamination by organic materials and the use of irrigation water. The identification of both assemblages A and B in soil samples is significant because they have been shown to be responsible for human illness associated with zoonotic transmission; this suggests that humans and animals could contaminate the environment with Giardialyticus by direct contact with each other and through the environment.

The close genetic relationship between local samples and samples reported from other human stool samples obtained from countries nearby helps substantiate this possible method of transmission. Detection rates of the Cryptosporidium genus were observed to be 31.5% of the samples indicating an ability to withstand environmental pressures, given the environmental pressure placed on the organisms. Cryptosporidium spp. oocysts were previously discovered to have the ability to survive in the soil and in water supplies for extended periods of time as a result of their ability to endure drying, fluctuations in temperature, and the effects of ordinary chemical disinfectants (Checkley et al. 2015) [5] . The phylogenetic analysis indicated that the isolates clustered with Cryptosporidium parvum, an important zoonotic pathogen that is often at the center of causes of human crypto outbreaks. Thus, it is plausible to consider agricultural fields to serve as sources of Cryptosporidium transmission, especially in regions with large livestock populations and where the practice of applying manure directly to fields remains common (Zahedi & Ryan 2020) [21] . The majority portion (23%) of all detected infectious agents was E. histolytica, which is a low-level organism; however, its detection still has some clinical significance based on its ability to cause symptomatic disease. The genetic relationship between the organisms identified at the time of testing was determined through the use of molecular analysis. The fact that E. histolytica and E. dispar (the non-pathogenic, morphologically identical organism) were closely related, and the use of PCR methods for determining the organism's identity would not have been feasible with microscopy techniques alone are significant advantages for using PCRbased molecular methods (Tachibana et al., 2012) [19] . Entamoeba spp. detected in agricultural soils indicates the existence of fecal contamination and unsatisfactory sanitation in the affected areas. Phylogenetic analysis of the three different protozoans all had low levels of genetic diversity, which indicates that the organisms form a tight cluster with similar reference strains. The findings point to stable patterns of transmission and potential common sources of contamination. The data emphasize the importance of incorporating molecular surveillance into standard protocols for environmental monitoring. To minimize protozoan contamination in agricultural soils, there is a need to improve methods for managing irrigation water, the use of animal manure, and sanitation practices. Therefore, it's crucial reduce the chances of transmitting protozoans from food production to humans through improved management of these aspects (Robertson et al., 2014) [16] .

Acknowledgement

AcknowledgmentsThe authors would like to thank Al-Qasim Green University's College of Veterinary Medicine for its laboratory facilities and technical assistance. Funding:The authors no receive funding

References

1. Al-Difaie RS. Molecular study to detect genotyping of Giardia lamblia from human and cattle feces in AlQadisiya Governorate, Iraq. Ibn Al-Haitham J Pure Appl Sci. 2016;29(3):1-13.
2. Alseady HH, Kawan MH. Prevalence and molecular identification of Cryptosporidium spp. in cattle in Baghdad province, Iraq. Iraqi J Vet Sci. 2019;33(2):38994.
3. Blackburn CC, Yan SM, McCormick D, Herrera LN, Iordanov RB, Bailey MD, et al. Parasitic contamination of soil in the Southern United States. Am J Trop Med Hyg. 2024;111(3):506. https://doi.org/10.1016/j.molbiopara.2008.04.006
4. Cacciò SM, Ryan U. Molecular epidemiology of giardiasis. Mol Biochem Parasitol. 2008;160(2):75-80.
5. Checkley W, White AC, Jaganath D, Arrowood MJ, Chalmers RM, Chen XM, et al. A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for Cryptosporidium. Lancet Infect Dis. 2015;15(1):85-94. https://doi.org/10.1016/S1473-3099(14)70772-8
6. El-Hamid ABD, Aiat A, Din SEMI, Azzam MI, Amer AS, Ghobashy MA. Distribution of enteric protozoa in the River Nile drains, Egypt using field and remote sensing studies. J Egypt Soc Parasitol. 2021;51(1):153162.
7. Feng Y, Xiao L. Molecular epidemiology of Giardia and Cryptosporidium infections in humans. Clin Microbiol Rev. 2017;30(1):67-112. https://doi.org/10.1128/CMR.00019-16
8. Ghazy RM, Alshaikhi SA, Assiri HAH, Almozaini AA, Alhazmi AF, Elhasaneen HEM, et al. Tropical diseases and the gastrointestinal tract: An overlooked connection. Front Trop Dis. 2025;6:1612952.
9. Kihara R, Mbugua A, Githigia SM, Kamuti NM, Munde BM. Prevalence and risk factors associated with zoonotic gastrointestinal parasites of dogs in Kitui Central SubCounty, Kitui, Kenya. PAMJ One Health. 2025;17(8).
10. Marhoon IA, Al-Aredhi HS. The effect of intestinal protozoan infections on hematological parameters and micronutrients in colorectal cancer patients. J Parasit Dis. 2025:1-7.
11. Mejia R, Slatko B, Almazan C, Cimino R, Krolewiecki A, Duran NM, et al. Molecular testing of environmental samples as a potential source to estimate parasite infection. Trop Med Infect Dis. 2024;9(10):226.
12. Mo Z, Quan J, Xu B, Yu H, Li J, Luo X, et al. A One Health study on phylogenetics and risk of pathogenic intestinal parasites at a ranch in Inner Mongolia. One Health. 2024;19:100912.
13. Namkuna HN. Prevalence and factors associated with gastrointestinal parasitic infestation among children presenting with acute diarrhea at Dodoma Regional Referral Hospital, Tanzania [Master's Thesis]. Dodoma: University of Dodoma; 2024.
14. Paul J. Gastrointestinal tract infections. In: Disease causing microbes. Cham: Springer International Publishing; 2024, p. 149-215.
15. Paul S, Chandra D, Tewari AK, Banerjee PS, Ray DD, Raina OK, Rao JR. Prevalence of Cryptosporidium andersoni: a molecular epidemiological survey among cattle in India. Vet Parasitol. 2009;161(1-2):31-5.
16. Robertson LJ, Sprong H, Ortega YR, van der Giessen JWB, Fayer R. Impacts of globalisation on foodborne parasites. Trends Parasitol. 2014;30(1):37-52. https://doi.org/10.1016/j.pt.2013.09.005
17. Rossi F, Santonicola S, Amadoro C, Marino L, Colavita G. Food and drinking water as sources of pathogenic protozoans: An update. Appl Sci. 2024;14(12):5339.
18. Ryan U, Paparini A, Monis P, Hijjawi N. It's officialCryptosporidium is a genus with multiple species. Trends Parasitol. 2019;35(7):503-7. https://doi.org/10.1016/j.pt.2019.04.012
19. Tachibana H, Yanagi T, Akatsuka A, Kobayashi S, Kanbara H, Takeuchi T. Differentiation of pathogenic Entamoeba histolytica and non-pathogenic Entamoeba dispar by PCR. J Clin Microbiol. 2012;50(9):3125-30. https://doi.org/10.1128/JCM.01253-12
20. World Health Organization. Guidelines on sanitation and health. Geneva: World Health Organization; 2017.
21. Zahedi A, Ryan U. Cryptosporidium-an update with an emphasis on foodborne and waterborne transmission. Res Vet Sci. 2020;132:500-512. https://doi.org/10.1016/j.rvsc.2020.08.015
22. Zeng J, Nakanishi T, Itoh S. Two-year monitoring of microbiological water quality in small water supply systems: implications for microbial risk management. Environ Manage. 2024;74(2):256-267.
23. Zhao ZY, Li MH, Lyu C, Meng XZ, Qin YF, Yang XB, et al. Prevalence of Giardia duodenalis among dogs in China from 2001 to 2021: A systematic review and metaanalysis. Foodborne Pathog Dis. 2022;19:179-91.