Molecular tagging of maturity associated long juvenility in soybean segregants

The E3 and E4 loci regulate flowering under specific long-day light qualities: E3 under high red:far-red (R:FR) conditions and E4 under low R:FR. Recessive e3 or e4 alleles enable flowering under their respective conditions, and both loci have been identified as Phytochrome A3 (E3) and Phytochrome A2 genes (E4) (Gupta et al., 2017) [14] . Soybean is a short-day plant, flowering when day length falls below a critical genotype-specific threshold (Destro et al., 2001) [12] . Sensitivity to photoperiod restricts adaptation across latitudes and limits sowing flexibility. Most maturity genes delay flowering, whereas their recessive mutant alleles promote earliness and broader adaptability. Molecular markers enable identification and transfer of such alleles into elite cultivars. From an agronomic perspective, precise control of flowering and photoperiod response is essential for maximizing yield and biomass within shorter crop durations (Cockram et al., 2007) [11] . At the molecular level, allelic combinations of maturity genes, particularly e1-e4, influence flowering time, with E1 exerting the strongest effect (Langewische et al., 2017) [19] . Beyond flowering, maturity loci also regulate photoperiodism and long juvenility.

Material and Methods

Materials

For the present study F₃ seeds of three soybean (Glycine max (L.) Merr.) crosses were obtained from the Soybean Breeder, Agricultural Research Station, K. Digraj, District Sangli, and sown during the Rabi off-season (4 October 2019) at the Post Graduate Institute Farm, Mahatma Phule Krishi Vidyapeeth, Rahuri, District Ahilyanagar. The genotype AGS 25 was used as the donor parent for the long juvenile trait, while EC 390977 was the donor parent for photoperiod insensitivity. Individually tagged F₃ plants were phenotyped, and 20 contrasting plants from each cross were selected for molecular analysis (Table 1).

Isolation of genomic DNA

Genomic DNA was extracted from tender leaves using the modified CTAB method (Doyle and Doyle, 1987) [13] . DNA pellets were dissolved in 100 μL TE elution buffer and their concentration measured by UV visible spectrophotometer (Nanodrop, USA) at 260 and 280 nm and by 0.8% (w/v) agarose gel electrophoresis along with known amount of λ phage DNA.

Based on this, all DNA samples were diluted to 20 ng μL⁻¹ with TE buffer.

Bulking of genomic DNA of early and late maturing plants

Two contrasting DNA bulks were prepared from early and late maturing F₃ plants after waiting for maturity data. Each bulk comprised equimolar DNA (30 ng) from 10 plants per group across the three crosses, uniform for maturity but variable for other traits. These bulks, along with parental DNA, were used for Bulked Segregant Analysis (BSA). Markers associated with maturity were subsequently validated on all individual F₃ samples.

Allele specific and SSR markers used for analysis of maturity loci in soybean cultivars

SSR markers linked to the E6 maturity gene (Tasma et al., 2018) [28] were used to investigate the long juvenile trait in soybean. Additionally, allele-specific markers derived from E3 and E4 loci (Tsubokura et al., 2013) [29] were employed to differentiate the three crosses. All primers used are listed in Table 2. BSA and subsequent validation of individual F₃ plants were performed with these primers, with samples arranged by maturity from early too late. All primers were custom synthesized by BioServe Biotechnologies (India) Pvt. Ltd. in lyophilized form and diluted prior to use following standard procedures to ensure uniform concentration. [29] R:TCCGATCTCATCACCTTTCC DNA amplification Allele specific and SSR primers PCR amplification for maturity loci was performed in 20 μL reactions containing 60 ng genomic DNA, 1 unit Taq DNA polymerase, 1X PCR buffer, 2 mM MgCl₂, 0.25 mM dNTPs, and 15 pmol of each primer. Mastermix was prepared, dispensed into PCR tubes with DNA, and amplified in a thermal cycler with initial denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 1 min, 52-58 °C for 1 min (annealing), and 72 °C for 2 min, with a final extension at 72 °C for 5 min. Amplified products were stored at 4 °C until electrophoresis and visualized using a gel documentation system after electrophoresis.

Results and Discussion

The study aimed to field evaluate segregating plants from three crosses involving donor parents for long juvenility / photoperiod insentivity trait and to further tag markers linked to long juvenility (using primers that differentially amplify for LJ trait E6 gene linked markers) and photoperiodism in soybean (using E3 and E4 loci specific primers).

Morphological characters

The morphological data of F₃ plants from three crosses are presented in Table 3, 4 and5 3). 5).

Analysis of LJ trait E6 maturity loci by using SSR markers

The E6 gene controlling the LJ character has been mapped to chromosome 4 of soybean (Li et al., 2017 [20] ; Yue et al., 2017) [32] . Its molecular identification and functional characterization provide insights into the genetic basis of the LJ trait (Li et al., 2017) [20] . In this study, the SSR markers LJ Satt 197 and LJ Satt 063, linked to E6 gene were used. E6 is an allele of J gene which confers earliness by acting as a suppressor of functional photoperiodic E1 gene that encodes a transcription factor that regulates photoperiodic flowering (Gupta et al., 2021) [15] .

PCR amplification of long juvenile trait linked SSR markers LJ Satt 197

The SSR primer Satt 197 was used for bulked segregant and individual plant validation of the LJ trait in soybean genomic DNA from two crosses (MAUS 71 × AGS 25 and MAUS 612 × AGS 25). In bulked segregant analysis, the normal (non-LJ) parents (MAUS 71 and MAUS 612) amplified at 196 bp, while the long juvenile parent (AGS 25) amplified at 179 bp; all bands were homozygous, with occasional faint non-specific bands. Netawane (2019) [22] similarly reported a 179 bp band in long juvenile genotypes AGS 25 and DT 21, associated with long juvenile and photoperiod-insensitive types, and suggested use of Satt 197179bp in marker-assisted selection (MAS). The individual plant analysis of Satt197 showed a consistent association with days to maturity in crosses MAUS 71 × AGS 25, amplifying fragments of either 179 bp to196 bp. Plants carrying the Satt197-196 bp allele, derived from the early parent MAUS 71 (DTM 95), matured earlier, between 89-99 days (7 out of 8 plants), closely aligning with the earliness of MAUS 71. In contrast, plants carrying the Satt197-179 bp allele, inherited from the long juvenile parent AGS 25 (DTM 115), tended to mature later, in the range of 100-103 days (4 out of 6 plants), reflecting the delayed genetic background of AGS 25. Heterozygotes exhibited maturity within 95-99 days (3 plants), lying between the two parents and suggesting partial dominance or additive interaction of the alleles. Whereas three plants did not show amplification. However, a few exceptions to this trend were noted, such as #5 (DTM 103) with Satt197-196 bp allele showing delayed maturity; whereas #2 (DTM 96) and #16 (DTM 98) displayed relatively early maturity although having Satt197-179 bp allele. Overall, Satt197 effectively discriminated between early and late maturing segregants, with Satt197-196 bp allele linked to earliness and Satt197-179 bp allele linked to lateness, while heterozygotes displayed values intermediate to the parents. In the cross MAUS 612 × AGS 25, the F₃ progenies showed a wider maturity range from 86 to 103 days, irrespective of the Satt197 allele class, reflecting variable segregation without a clear allelic trend, as no significant difference was observed in maturity period between the parents MAUS 612 (105 days) and AGS 25 (115 days) to distinguish. Thus, Satt 197 reliably amplified an E6 locus-specific marker (Tasma et al., 2018) [28] . The extensive LJ character soybean breeding in Brazil resulting in development of short-day length adapted soybean cultivars that cover 23.7% of the total world production (Gupta et al., 2021 [15] ; Junior et al., 2024) [17] .

LJ satt 063

In this study, the SSR primer Satt 063 was used for bulked segregant and individual plant validation of the LJ trait in two crosses (MAUS 71 × AGS 25 and MAUS 612 × AGS 25). In bulked segregant analysis, non-LJ parents (MAUS 71 and MAUS 612) it amplified a 122 bp band, while the LJ parent (AGS 25) amplified a 116 bp band. Early and late-maturing bulks were heterozygous, carrying both bands. Netawane (2019) [22] similarly reported a 116 bp band in LJ genotypes AGS 25 and DT 21 and highlighted its utility for MAS. In cross MAUS 71 × AGS 25, plants carrying the Satt063-122 bp allele (4 out of 6) matured in the 95-98 day range, which is closely aligning with MAUS 71 parent (95 days), while plants with the Satt063-116 bp allele (6 out of 7) displayed delayed maturity within range of 99-103 days leaning towards the long juvenile AGS 25 parent (115 days). Heterozygotes (5 plants) expressed early to intermediate days to maturity (89-98 days), representing a broader range. Whereas two plants did not show amplification. Exceptions were notable, such as #9 with Satt063-116 bp allele matured earlier (94 days); while, plants #19 (100 days) and #5 (103 days) matured late even though having Satt063-122 bp allele which did not conform to the general tendency. Overall, the allelic groups overlapped considerably and heterozygotes exhibited wider variation. Similarly in cross MAUS 612 × AGS 25, plants carrying the Satt063-122 bp allele (2 out of 2) matured between 96-98 days aligning little close with the parent MAUS 612 (105 days), while those with the Satt063-116 bp allele (3 out of 4) exhibited range of 99-103 days, having relatively delayed maturity as like long juvenile parent AGS 25 (115 days). However the plant #5 marked exception of having early maturity (95 days) though having Satt063-116 bp allele. The heterozygotes (14 plants) formed the wide range of 86-102 days, thus spanning the entire segregating range. In individual DNA validation, this primer amplified an E6 locus-specific marker as earlier reported by Tasma et al. (2018) [28] . They suggested that breeding for LJ characters can help to improve soybean productivity in low latitude tropical countries like Indonesia. Recently used SSR markers have been used for development of soybean adopted for short photoperiod tropical areas (Wibisono et al., 2025) [30] .

PCR amplification and analysis of E1, E3 and E4 locus specific markers

 E4 marker: The E4 locus-linked allele-specific CAPS marker (Tsubokura et al., 2013) [29] was used to score bulked DNA samples from three soybean crosses. The E4 primer pair amplified two monomorphic bands at 58°C annealing temperature (225 bp and 325 bp) in MAUS 71 × AGS 25 and MAUS 612 × AGS 25. In MAUS 71 × AGS 25, the early bulk was homozygous (325 bp) while the late bulk was heterozygous (225 bp and 325 bp). In MAUS 612 × AGS 25, both early and late bulks were heterozygous (225 bp and 325 bp). No amplification was observed in EC 390977 × EC 538828, including the photoperiod-insensitive parent (EC 390977), despite multiple attempts. As monomorphism was observed in bulked samples, no further individual validation was performed. These results indicate the E4 CAPS marker can detect allelic variation in flowering time in some soybean crosses but may not amplify in photoperiod-insensitive genotypes.  e3-tr marker: The E3 locus-linked dCAPS marker (Tsubokura et al., 2013) [29] was used to score genomic DNA from three soybean crosses, the e3-tr primer pair amplified 300 bp and 900 bp bands at 58°C annealing temperature in MAUS 71 × AGS 25 and MAUS 612 × AGS 25, with heterozygosity except for two homozygous plants (#3 and #20) in MAUS 612 × AGS 25. In EC 390977 × EC 538828, only a 300 bp band was observed. Amplified sizes differed slightly from the expected 274 bp (without restriction digestion by restriction enzyme MseI) and 324 bp (after MseI digestion; Tsubokura et al., 2013) [29] . EC 390977 parent is reported as E1E1 E2E2 e3-tr e3-tr E4E4 (Gupta et al., 2017) [14] . Plants with -e3 genotype identified via FLP were either E3e3 or e3e3 by SSR. MseI digestion could not be performed due to unavailability of the enzyme.  e3-Ha marker: The E3 locus-linked dCAPS marker (Tsubokura et al., 2013) [29] was used to score genomic DNA from three soybean crosses. On [29] .  E3-Mi marker: The E3 locus-linked dCAPS marker (Tsubokura et al., 2013) [29] was used to score genomic DNA from three soybean crosses. The e3-Mi primer pair showed no amplification in MAUS 71 × AGS 25 and MAUS 612 × AGS 25. In EC 390977 × EC 538828, a 250 bp homozygous band was observed at in all early and late plants except 1 early plant (#3), where amplification was absent. The observed size differed from the expected 1339 bp (Tsubokura et al., 2013) [29] .  E1-as marker: The E1 locus-linked allele-specific CAPS marker (Tsubokura et al., 2013) [29] was used to score

Conclusion

The present study demonstrated the utility of SSR markers Satt197 and Satt063 in characterizing allelic variation at the E6 locus associated with the long juvenile (LJ) trait in soybean. Satt197 showed a clear association with days to maturity, effectively grouping segregants into early, late, and intermediate classes, thereby reflecting the genetic contribution of parental alleles. Similarly, Satt063 successfully distinguished allele classes, where homozygotes formed relatively consistent groups, while heterozygotes displayed wider variability, contributing to greater segregation in maturity duration. Overall, both markers proved reliable for identifying allelic differences at the E6 locus

Acknowledgement

The authors are thankful to the authorities of the Mahatma Phule Krishi Vidyapeeth, Rahuri for providing facilities to undertake this work.

References

1. Bernard RL. Two major genes for time of flowering and maturity in soybean. Crop Sci. 1971;11:242-244.
2. Bonato ER, Vello NA. E6 dominant gene conditioning early flowering and maturity in soybeans. Genet Mol Biol. 1999;22:229-32.
3. Buzzell RI. Inheritance of soybean flowering to florescent day length condition. Can J Genet Cytol. 1971;13:703-707.
4. Buzzell RI, Voldeng HD. Inheritance of insensitivity to long day length. Soybean Genet Newsl. 1980;7(13):26-29.
5. Cairo AC, Stein J, Delgado L, Bortolotti S, Guelman AS, Ortiz PJ, Morandi NE. Tagging the juvenile locus in soybean (Glycine max [L.] Merr.) with molecular markers. Euphytica. 2002;124(3):387-95.
6. Cao D, Takeshima R, Zhao C, Liu B, Abe J, Kong F. Molecular mechanisms of flowering under long days and stem growth habit in soybean. J Exp Bot. 2016;68(8):187384.
7. Cober ER, Voldeng HD. E3 and Dt1 linkage. Soybean Genet Newsl. 1996;23:56-57.
8. Cober ER, Tanner JW, Voldeng HD. Genetic control of photoperiod response in early-maturing, near-isogenic soybean lines. Crop Sci. 1996;36:601-605.
9. Cober ER, Voldeng HD. A new soybean maturity and photoperiod-sensitivity loci respond differentially to light quality. Crop Sci. 2001;36:606-610.
10. Cober ER, Molnar SJ, Charette M, Voldeng HD. A new locus for early maturity in soybean. Crop Sci. 2010;50:524527.
11. Cockram J, Jones H, Leigh FJ, O'Sullivan D, Dowell W, Laurine DA, Greenland AJ. Control of flowering time in temperate cereals: Genes, domestication and sustainable productivity. J Exp Bot. 2007;58:1231-1244.
12. Destro D, Pipolo CV, Kiihl RA, Almeida LA. Photoperiodism and genetic control of the long juvenile period in soybean: A review. Crop Breed Appl Biotechnol. 2001;1(1):72-92.
13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;19:11-5.
14. Gupta S, Bhatia V, Kumawat G, Thakur D, Singh G, Tripathi R, et al. Genetic analyses for deciphering the status and role of photoperiodic and maturity genes in major Indian soybean cultivars. J Genet. 2017;96(1).
15. Gupta S, Agrawal N, Tripathi R, Kumawat G, Nataraj V, Maranna S, et al. Long juvenility trait: A vehicle for commercial utilization of soybean (Glycine max) in lower latitudes. Plant Breed. 2021;140(4):543-60.
16. Jiang B, Haiyang N, Tang L, Lu S, Gao Y, Ma L, et al. Allelic combinations of soybean maturity loci E1, E2, E3 and E4 result in diversity of maturity and adaptation to different latitudes. PLOS One. 2013;9(8):1-11.
17. Junior HS, Harada A, Destro D, Kiihl RAS. Adaptation of soybean to low latitudes using alleles for long juvenile period. Agron Sci Biotechnol. 2024;10:1-16.
18. Kong F, Nan H, Cao D, Li Y, Wu F, Wang J, et al. A new dominant gene E9 conditions early flowering and maturity in soybean. Crop Sci. 2014;54(6):2529-35.
19. Langewisch T, Lenis J, Jiang LG, Wang D, Pantalone V, Bilyeu K. The development and use of a molecular model for soybean maturity groups. BMC Plant Biol. 2017;17:91.
20. Li X, Fang C, Xu M, Lu S, Su T, Li S, et al. Quantitative trait locus mapping of soybean maturity gene E6. Crop Sci. 2017;57:2547-2554.
21. McBlain BA, Bernard RL. A new gene affecting the time of flowering and maturity in soybeans. J Hered. 1987;78(3):160-162.
22. Netawane AL. Molecular characterization of maturity genes of soybean [Glycine max (L.) Merril] involved in photoperiod-insensitivity and long juvenile trait [M.Sc. Thesis]. Rahuri: Mahatma Phule Krishi Vidyapeeth; 2019, p. 57.
23. Ray JD, Hinson K, Mankono JE, Malo MF. Genetic control of a long juvenile trait in soybean. Crop Sci. 1995;35:10016.
24. Saidon G, Beversdorf W, Voldeng H. Adjusting of the soybean phenology using the E4 loci. Crop Sci. 1989;29(6):1361-1365.
25. Samanfar B, Molnar SJ, Charette M, Schoenrock A, Dehne F, Golshani A, et al. Mapping and identification of a potential candidate gene for a novel maturity locus, E10 in soybean. Theor Appl Genet. 2017;130(2):377-390.
26. Sun H, Jias Z, Cao D, Jiang B, Wu C. GmFT2a, a soybean homolog of locus flowering T, is involved in flowering transition and maintenance. PLOS One. 2011;6(12):13711378.
27. Tardivel A, Donogheu L, Sonah H, Belzile F. Rapid identification of alleles at the soybean maturity gene E3 using genotyping by sequencing and a haplotype-based approach. Plant Genome. 2014;7(2):1-9.
28. Tasma MI, Mega PN, Yani GM, Purwaningdyah R, Satyawan D, Nugroho K, et al. Genetic diversity analysis and F2 population development for breeding of long juvenile trait in soybean. J AgroBiogen. 2018;14(1):11-22.
29. Tsubokura Y, Matsumura H, Xu M, Liu B, Nakashima H, Anai T, et al. Genetic variation in soybean at the maturity locus E4 is involved in adaptation to long days at high latitudes. Agronomy. 2013;3:117-134.
30. Wibisono K, Dyah RP, Utari R, Suparjo S, Umar U, Rijzaani H, et al. Genetic diversity and DNA barcoding construction of tropical soybean advanced lines based on SSR markers. J Ilmu Pertan Indones. 2025;30(2):293-304. https://doi.org/10.33158/ASB.r218.v10.2024.
31. Xia Z, Watanabe S, Yamada T, Tsubokura Y, Nakashima H, Zhai H, et al. Positional cloning and characterization reveal the molecular basis for soybean maturity locus E1 that regulates photoperiodic flowering. Proc Natl Acad Sci U S A. 2012;109(32):2155-2164.
32. Yue Y, Liu N, Jiang B, Li M, Wang H, Jiang Z, et al. A single nucleotide deletion in J gene encoding GmELF3 confers long juvenility and is associated with adaption of tropic soybean. Mol Plant. 2017;10(4):656-658.