Molecular screening and identification of restorer lines for fertility restorer genes Rf3 and Rf4 in Rice (Oryza sativa L.)

Introduction

Rice (Oryza sativa L.) serves as a fundamental cereal grain supporting global populations and maintaining profound socioeconomic importance throughout multiple nations. Within this botanical genus, 24 species exist-comprising 22 indigenous varieties and 2 cultivated forms-demonstrating remarkable genetic variability. The chromosomal architecture varies between nine tetraploid species (containing 48 chromosomes) and the remaining diploid species (possessing 24 chromosomes). Within India's agricultural landscape, rice cultivation represents the predominant farming activity, encompassing the most extensive cropping area while substantially contributing to the nation's nutritional security. Contemporary agricultural statistics (Indiastat, 2023-24) [3] reveal production across 47.82 million hectares, generating approximately 138.72 million metric tons with mean productivity reaching 2, 882 kg/ha. The state of Telangana exemplifies exceptional production efficiency, achieving 16.87 million tons from 4.68 million hectares, resulting in superior yield rates of 3, 602 kg/ha. Meeting escalating worldwide food requirements necessitates productivity enhancement through sophisticated breeding methodologies (Veeresha et al., 2015) [9] . Hybrid rice development, integrating conventional breeding approaches with contemporary molecular tools, has demonstrated remarkable success in creating superior F₁ hybrid varieties (Huang et al., 2014; Khush, 2013; Vaz Mondo et al., 2016) [2,4,8] . China maintains its position as the foremost adopter of hybrid rice technology globally, while India has progressively incorporated these methodologies to enhance agricultural output. A revolutionary breakthrough emerged during the 1970s with the identification of Wild Abortive Cytoplasmic Male Sterility (WA-CMS) within a naturally occurring mutant of Oryza sativa f. spontanea. The inaugural commercial CMS line, derived from a sterile specimen discovered on Hainan Island in 1973, established the groundwork for the three-line hybrid methodology, currently representing the most extensively employed technique (Shih-Cheng et al., 1980; Yuan, 1998; Virmani et al., 1983) [7,12,10] . This breeding system, alternatively termed cytoplasmic-genic male sterility (CGMS), functions through three essential components: a male-sterile (CMS) line, a maintainer line, and a restorer line containing fertility-restoring (Rf) genetic elements. Indian hybrid rice production predominantly utilizes the WA-CMS-based three-line approach, although securing dependable restorer lines continues to present significant challenges. Among the 17 documented fertility restoration genes in rice-predominantly exhibiting dominant inheritance patterns excluding rf17-the Rf3 gene (located on chromosome 1) and Rf4 gene (positioned on chromosome 10) demonstrate essential functions in WA-CMS hybrid development (Zhang et al., 1997; Yao et al., 1997) [13,11] . Molecular marker technology, including systems established by Alavi et al. (2009) [1] , facilitates effective marker-assisted selection (MAS) protocols for restorer line identification, reducing dependence on timeintensive test crossing procedures. Research findings (Revathi et al., 2013) [6] demonstrate 85-92% precision in forecasting functional restorer performance through marker implementation Revathi et al., (2013) [6] . Verified restorer lines subsequently undergo hybridization with superior Alines to produce high-performance hybrids, followed by comprehensive assessment of agronomic characteristics, grain attributes, and combining capacity. The objective of this investigation was to validate molecular markers linked with Rf3 and Rf4 genes to enhance the efficiency of identifying effective restorers within WA-CMS hybrid breeding initiatives.

Materials and Methods

This investigation was executed throughout the 2024 Kharif cropping period at the Rice Research Unit (RRU) within the Agricultural Research Institute of Professor Jayashankar Telangana Agricultural University, situated at Rajendranagar, Hyderabad, in Telangana state, India. The experimental material comprised 36 rice genetic resources sourced from dual origins: the local RRU facility at ARI, Rajendranagar, and the International Rice Research Institute (IRRI) based in the Philippines. Following the initial season, molecular characterization of these 36 breeding lines was performed during the succeeding Kharif period (2025) to identify the presence of fertility restoration loci Rf3 and Rf4 using marker-based detection methods. The genetic screening protocol incorporated targeted molecular markers specifically linked to these restoration genes: RM-SF21-5 and RMS-PRR9-1. A comprehensive listing of all genotypes subjected to this molecular characterization process is presented in Table 1.

Molecular analysis: DNA isolation and marker detection

Total genomic DNA isolation from 36 candidate restorer genotypes was accomplished through a conventional CTABbased extraction methodology. Fresh leaf material (roughly 100 mg) was harvested into sterile, pre-coded 2 mL microcentrifuge vessels containing a sterilized metallic bead and promptly preserved at-80 °C prior to analysis. During DNA isolation procedures, cryopreserved plant tissue underwent mechanical disruption in 500 μL CTAB extraction buffer utilizing a tissue homogenizer (300 rpm, 2 min duration), subsequently supplemented with an additional 500 μL CTAB buffer and maintained at 65 °C for 45 minutes. Following high-speed centrifugation (12, 000 × g, 15 min, 4 °C), the clarified supernatant underwent purification using chloroform: isoamyl alcohol (24:1 ratio). DNA precipitation was achieved through isopropanol treatment at 4 °C for overnight duration, followed by 70% ethanol washing, and final reconstitution in 50 μL TE buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Spectrophotometric analysis determined DNA quantity and quality parameters. [5] 2. RMS PRR 9-1 (Rf4) F GAGTTTTGAATAGATTTACGTGTGGA R AGTGTCCAGATTCGTAGTAATGC 10 55 °C Pranathi et al., 2016 [5]

Findings and Interpretation

Genetic characterization of 36 rice breeding lines through molecular marker analysis effectively revealed genotypes harbouring Rf3 and Rf4 fertility restoration loci utilizing locus-specific DNA markers. Application of the RM-SF21Conversely, the remaining 17 breeding lines (constituting 47.2% of the collection) produced exclusively the 127 bp amplification fragment, signifying the absence of functional Rf3 restoration capacity. These findings underscore the efficacy of marker-assisted breeding strategies for detecting candidate restorer genotypes, with the RM-SF21-5 marker system exhibiting distinct polymorphic differentiation between restoration-competent and restoration-deficient materials. The substantial frequency (52.8%) of Rf3carrying lines within this genetic resource collection indicates these accessions possess considerable utility for three-line hybrid rice development programs employing the WA-CMS breeding approach. The distinct electrophoretic band patterns documented (Figure 1) further confirm the dependability of this molecular marker system for extensive screening applications across breeding populations. The distinct polymorphic patterns documented between restoration-capable and restoration-deficient genotypes (Fig. 2) confirm the utility of the RMS-PRR9-

Conclusion

This investigation effectively characterized 19 rice breeding genotypes harboring the Rf3 genetic variant and five accessions possessing the Rf4 element through molecular characterization utilizing RM-SF21-5 and RMS-PRR9-1 marker systems, respectively. Significantly, genotype SN3422 was determined to contain both Rf3 and Rf4 restoration elements simultaneously, establishing it as an exceptionally important genetic asset for hybrid rice development initiatives. The deployment of these codominant marker technologies delivers a streamlined and dependable methodology for marker-assisted breeding, presenting numerous benefits compared to traditional cultivation approaches. Particularly, this molecular strategy facilitates preliminary screening of restorer accessions during early developmental phases, substantially minimizing temporal and resource investments relative to conventional test-crossing procedures. The marker systems exhibited exceptional precision, with the 172 bp amplification product consistently confirming active restorer genetic variants.These outcomes establish a robust molecular framework for expediting the advancement of superior hybrid rice cultivars through accurate detection of fertility restoration genes within breeding collections. The characterized restorer accessions, especially those harbouring dual Rf elements, constitute important genetic materials for improving hybrid rice performance and consistency.

Future Scope

The genetic characterization revealed 19 breeding accessions harbouring Rf3 and 5 genotypes possessing Rf4, supplying essential parental components for hybrid rice cultivation programs. These materials can be systematically hybridized with WA-CMS genotypes to generate superior hybrid combinations, subsequently undergoing thorough assessment of fertility restoration mechanisms (achieving 90%+ pollen viability and reproductive success), agricultural performance metrics (production capacity, environmental resilience), and kernel characteristics (processing efficiency, starch composition).The dual Rf3/Rf4 combination genotype SN3422 presents exceptional potential for establishing resilient restoration frameworks. Subsequent breeding initiatives should prioritize incorporating supplementary Rf elements and fertility-associated quantitative trait loci to construct polygenic restoration networks, thereby improving environmental stability and minimizing restoration failure risks. This marker-guided methodology substantially expedites breeding timelines relative to traditional approaches, compressing assessment periods from 4-5 years to single seasonal cycles while preserving accuracy in restorer genotype development. The synthesis of molecular characterization with established breeding protocols will enable advancement of innovative hybrid rice cultivars featuring enhanced production consistency and expanded environmental adaptability.

Acknowledgement

AcknowledgmentThe authors acknowledge Professor Jayashankar Telangana Agricultural University (PJTAU) for their generous financial assistance in support of the research work presented in this study.

References

1. Alavi M, Ahamadikhan A, Kamkar B, Kalateh M. Mapping Rf3 locus in rice by SSR and CAPS markers. International Journal of Genetics and Molecular Biology. 2009;7:121-126.
2. Huang JZ, E ZG, Zhang HL, Shu QY. Workable male sterility systems for hybrid rice: Genetics, biochemistry, molecular biology, and utilization. Rice. 2014;7:1-14.
3. Khush GS. Strategies for increasing the yield potential of cereals: case of rice as an example. Plant Breeding. 2013;132(5):433-436.
4. Pranathi K, Viraktamath BC, Neeraja CN, Balachandran SM, Rao PK, Revathi P, et al. Development and validation of candidate gene-specific International Journal of Advanced Biochemistry Research https://www.biochemjournal.com markers for the major fertility restorer genes, Rf4 and Rf3 in rice. Molecular Breeding. 2016;36(10):1-14.
5. Revathi P, Medoju P, Singh AK, Sundaram RM, Raju S, Senguttuve P, et al. Efficiency of molecular markers in identifying fertility restoration trait of WA-CMS system in rice. Indian Journal of Genetics and Plant Breeding. 2013;73(1):89-93.
6. Shih-Cheng L, Yuan LP. Hybrid rice breeding in China. In: Innovative approaches to rice breeding: Selected papers from the 1979 International Rice Research Conference. Los Baños (Philippines): International Rice Research Institute; 1980. p. 35-51.
7. Vaz Mondo VH, Nascente AS, Neves PDCF, Taillebois JE, Neto MOAC. Flowering synchronization in hybrid rice parental lines. Australian Journal of Crop Science. 2016;10(8):1213-1221.
8. Veeresha BA, Hanamaratti N, Salimath PM. Heterosis and combining ability studies for yield and productivity traits in rice. International Journal of Current Agricultural Research. 2015;4(5):120-126.
9. Virmani SS, Edwards IB. Current status and future prospects for breeding hybrid rice and wheat. Advances in Agronomy. 1983;36:145-214.
10. Yao FY, Yu SB, Gao YJ, Zhang Q. Mapping and genetic analysis of two fertility restorer loci in the wild abortive cytoplasmic male sterility system of rice (Oryza sativa L.). Euphytica. 1997;98:183-187.
11. Yuan LP. Hybrid rice breeding in China. In: Advances in Hybrid Rice Technology. Los Baños (Philippines): International Rice Research Institute; 1988. p. 27-33.
12. Zhang G, Bharaj TS, Lu Y, Virmani SS, Huang N. Mapping of the Rf3 nuclear fertility-restoring gene for WA cytoplasmic male sterility in rice using RAPD and RFLP markers. Theoretical and Applied Genetics. 1997;94:27-33.