Investigation of Booroola fecundity gene polymorphism and its correlation with litter size in Sirohi and Barbari goat breeds

Introduction

Successful reproduction results from the complex interplay between genes and environmental factors, ensuring the transfer of genetic traits across generations. Identifying key mutations in candidate genes, understanding their impact on reproductive traits, and enhancing fertility such as increasing litter size can provide an efficient and cost-effective approach to accelerating breeding programs. Genetic polymorphism studies on candidate genes linked to productive and reproductive traits can facilitate the selection and propagation of elite goat populations. A lot of research has been done on the genes that affect litter size in various species, and this has led to the discovery of important genes that play a role in this trait across different sheep breeds, such as the Booroola gene (Pardeshi et al., 2009) [9] . The Booroola fecundity gene (FecB) has a specific mutation, Q249R (CAG → CGG), This particular mutation is associated with the hyper-prolific trait seen in Booroola ewes (Mulsant et al., 2001) [8] .

Materials and Methods

The research consisted of Sirohi and Barbari goat breeds. A total of 40 blood samples and related performance data including milk yield, litter size, birth weight, weaning weight, and six-month body weight were collected from 20 goats of each breed.

Genomic DNA isolation

We collected about 5 mL of blood from each animal's jugular vein, using EDTA-coated vacutainers for the samples. These were then transported to the lab while keeping them cool, stored at 4 °C until we were ready to process them. To extract genomic DNA from the whole blood, we followed the classic phenol-chloroform method outlined by John et al. (1991) [6] , purity and concentration of the DNA checked at 260 and 280 nm.

To ensure the genomic DNA was intact, we ran it through 0.8% agarose gel electrophoresis at 80 V for 60 minutes. After that, diluted DNA samples used for PCR amplification.

Polymerase chain reaction (PCR)

Samples with greater DNA concentrations were diluted to 30 ng/µL with nuclease-free water (Sigma). The PCR process used 3 µL of DNA as its template. To amplify the Booroola gene, custom-synthesized tetra primers unique to the gene (1110 bp) were used, as described by Polley et al., 2009 [10] . [10] Primer F2 Primer R2 5'GTCGCTATGGGGAAGTTTGGATGGGAA A 3' 3' ATGTTTTCATGCCTCATCAACACCGTCC 5'

To perform PCR reaction 2.0 µL of diluted genomic DNA, 1.0 µL of primers (inner and outer), 8.5 µL of nuclease-free water (NFW) along with 12.5 µL of 2X master mix was used making a total volume 25 µL. the temperature on the thermocycler was set as initial denaturation of 4 min at 94 °C, followed by 30 cycles of denaturation of 30 seconds at 94 °C, annealing at 63 °C for 40 seconds and extension at 72 °C for 1 minute. A final extension performed for 6 minutes at 72 °C.

To check the PCR products 1.8% agarose gel was used along with ethidium bromide (500 ng/µL) in 1X TBE buffer. 5 µL of amplified DNA in the specific well with 100bp DNA ladder on first well was put and electrophoresis was carried out at 90 volts for 60 minutes at. DNA bands were examined under gel documentation system.

PCR-RFLP assay

For the PCR-RFLP assay, amplified PCR products were subjected to enzymatic digestion using the AvaII restriction endonuclease, selected based on the presence of its recognition site within the target DNA sequence. Postdigestion, the enzyme was thermally inactivated, and the resulting restriction fragments were resolved through agarose gel electrophoresis. The banding patterns were visualized and recorded using a gel documentation system, facilitating subsequent genotypic analysis. The restriction digestion reaction was carried out in a 30 µL reaction volume, comprising 15 µL of PCR amplicon, 2 µL of 10X Buffer H (manufacturer's recommendation), 1 µL of AvaII enzyme (procured from Takara Bio), and 12 µL of NFW. The reaction mixture was briefly centrifuged to ensure homogeneity and incubated at 37 °C for 3 hours in a water bath to complete digestion.

Table 2:

The restriction enzyme employed for the digestion of the PCR product, along with its specific recognition site

The amplifies PCR products were electrophoresed on a 2.5% agarose gel with 1% ethidium bromide (5 µL per 100 mL). Gel run was performed using 0.5X TBE buffer at a constant voltage of 80-90 V for 60-90 minutes. To monitor the PCR-RFLP product, 2.0 µL of bromophenol blue was added per 10 µL of the product. A molecular weight standard was loaded using a Mass Ruler Low Range DNA Ladder (100 bp). A UV transilluminator was used to see the DNA bands, which were then recorded using a gel documentation system. Fragment sizes were assessed by comparing them to the molecular marker, and the Booroola gene was genotyped using the particular banding patterns for each genotype.

Estimation of genotypic and allelic frequency

Gene and genotype frequencies of the fecundity genes under investigation were calculated using Popgene 32 software (version 1.32) as described by Yeh et al. (1999) [12] . To determine whether the populations of the different breeds conformed to Hardy-Weinberg equilibrium at the target locus, a Chi-square (χ²) test was performed.

Results and Discussion

Genomic DNA extraction and amplification of Booroola gene All genomic DNA samples were found to have sufficient concentrations and were checked for quality, using 0.8% agarose gel, all samples showed bright distinct bands under a UV transilluminator indicating that the extracted DNA was intact (Plate 1). The OD260/OD280 ratio from the Nano Drop ranged from 1.7 to 1.9 indicating high purity with little protein or contaminant contamination. All PCR products targeting the Booroola gene of Sirohi and Barbari goat breeds generated single clear bands about 1110 bp in size, as seen on a 1.8% agarose gel and 100 bp DNA ladder for reference. The system (gel) was run at 90 V for 60 minutes. The amplified PCR products were visualized under a UV light gel documentation system (Plate 02).

Restriction digestion and RFLP analysis

The PCR amplicons of the Booroola gene from each sample were subjected to digestion using the AvaII restriction enzyme. The analysis indicated the absence of the AvaII recognition site, as all samples exhibited a single undigested band of 1110 bp, with no evidence of restriction (Plate 03). Bhalavi et al. (2021) [2] [5] .

Gene and Genotype frequency at Booroola gene locus

In the current study, all individuals from the Sirohi (N=20) and Barbari (N=20) goat populations were found to be monomorphic at the Booroola gene locus. The allele frequencies for the A and B alleles were determined to be 1.00 and 0.00, respectively, in both breeds. Similarly, the observed genotype frequencies for AA, AB, and BB were 1.00, 0.00, and 0.00, respectively, in both Sirohi and Barbari goats (refer to Table 3).

A single restriction pattern corresponding to the AA genotype (1110 bp) of the Booroola gene was detected in all samples.

No individuals with AB or BB genotypes were identified in the studied populations of both Sirohi and Barbari goats. The genotypic frequency of AA was calculated as 1.00. Results of the Chi-square analysis for deviation from HWE revealed to be non-significant between the observed and expected genotype frequencies (p>0.05), indicating that both Sirohi and Barbari populations were in HWE at the Booroola gene locus. Ahlawat et al. (2014) [1] observed similar findings related to the when they observed BMPR1B gene in eight native Indian goat breeds. They also reported uniform absence of polymorphism in all goat breeds. The results of this study are in accordance with previous findings, of Kumar et al. (2008) [7] observing HWE in Malpura and Kendrapada sheep, He et al. (2010) [4] reporting in Chinese goat populations and Godara et al. (2012) [3] also in Marwari goats which lack genetic variation at the Booroola gene locus in goats. Association study of genotypes of Booroola gene with Litter size in Sirohi and Barbari goat breeds All screened samples from both Sirohi and Barbari goats was found to be monomorphic at the Booroola gene locus. As a result, it was not possible to conduct an association analysis between this gene and litter size variation. Nonetheless, a comparative analysis of mean litter size between the two breeds is presented below.

Litter Size (LS)

A statistically significant influence of genotype (p<0.05) was observed on the litter size trait. The average litter size at first kidding was analyzed and compared between Sirohi and Barbari goat breeds. Comparable results were documented by Bhalavi et al. (2021) [2] , who reported a markedly greater litter size in Black Bengal goats when compared to Barbari and Sirohi breeds. In the current investigation, only the AA genotype was identified across all individuals from both Sirohi and Barbari breeds. The average litter size corresponding to the AA genotype was 1.70±0.16 in Barbari goats, while in Sirohi goats it was recorded at 1.25±0.09. The effect of breed on litter size was statistically noteworthy (p<0.05), with Barbari goats showing a significantly higher litter size than their Sirohi counterparts (see Table 4).

Conclusion

In the present study, the Booroola fecundity gene (1110 bp) exhibited a monomorphic pattern in both Sirohi and Barbari goat breeds. The A allele was found to have a gene frequency of 1.00, while the B allele was absent (frequency = 0.00). Correspondingly, the genotypic frequencies of AA, AB, and BB genotypes were 1.00, 0.00, and 0.00, respectively, in both breeds. The comparative analysis of litter size between the two breeds revealed a significantly higher average litter size in Barbari goats compared to Sirohi goats.

Conflict of Interest Not available

Financial Support

References

1. Ahlawat S, Sharma R, Roy M, Mandakmale S, Prakash V, Tantia MS. Genotyping of novel SNPs in BMPR1B, BMP15, and GDF9 genes for association with prolificacy in seven Indian goat breeds. Anim Biotechnol. 2016;27(3):199-207.
2. Bhalavi D, Thakur MS, Khare V, Joshi S, Jain A, Sharma M, et al. Genetic polymorphism of BMPR1B and BMP15 genes and their association with reproductive and growth traits in Barbari, Sirohi and Black Bengal goats. J Entomol Zool Stud. 2021;9:373-378.
3. Godara A, Gahlot GC, Ashraf M, Ghorui SK. Polymorphism of growth hormone BMP-15 gene in Marwari goat. Indian J Small Rumin. 2012;18(1):32-36.
4. He Y, Ma X, Liu X, Zhang C, Li J. Candidate genes polymorphism and its association to prolificacy in Chinese goats. J Agric Sci. 2010;2(1):88.
5. Islam M, Basheer A, Javed K, Anjum AA, Zahoor I. PCR-RFLP-based identification of polymorphisms in BMPR1B, GDF9 and BMP15 genes associated with litter size in Beetal and Teddy goats. S Afr J Anim Sci. 2019;49(4):697-708.
6. John SW, Weitzner G, Rozen R, Scriver CR. A rapid procedure for extracting genomic DNA from leukocytes. Nucleic Acids Res. 1991;19(2):408.
7. Kumar S, Mishra AK, Kolte AP, Dash SK, Karim SA. Screening for Booroola (FecB) and Galway (FecXG) mutations in Indian sheep. Small Rumin Res. 2008;80(13):57-61.
8. Mulsant P, Lecerf F, Fabre S, Schibler L, Monget P, Lanneluc I, et al. Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Merino ewes. Proc Natl Acad Sci U S A. 2001;98(9):5104-5109.
9. Pardeshi VC, Maddox JM, Kadoo NY, Gupta VS. Genetic modulation of the FecB gene expression. In: ACIAR Proc Ser. 2009;133:57-65.
10. Polley S, De S, Batabyal S, Kaushik R, Yadav P, Arora JS, et al. Polymorphism of fecundity genes (BMPR1B, BMP15 and GDF9) in the Indian prolific Black Bengal goat. Small Rumin Res. 2009;85(2-3):122-129.
11. Singh HK, Sharma D, Singh SP, Tiwari M, Pandey V. Investigation of major fecundity Booroola gene (FecB) polymorphism in Indian Barbari goat breed. Indian Vet J. 2013;90(11):16-18.
12. Yeh FC. POPGENE (version 1.3.1). Microsoft Windowsbased freeware for population genetic analysis; 1999. Available from: http://www.ualberta.ca/~fyeh/