Molecular identification of antibiotic resistance profile and virulence genes in Staphylococcus aureus from human and animal sources

Introduction

Staphylococcus aureus is a Gram-positive coccus. It does not move and can survive in harsh environments (Al-Daraghi, 2022) [1] . It grows well in both oxygen and low-oxygen conditions. This makes it a common pathogen in many places (Al-Daraghi, 2022) [1] . S. aureus lives in both humans and animals. It is often found in animals used for food. These bacteria can enter the food chain during slaughter, handling, or packaging (Alkuraythi et al., 2023) [4] . This bacterium causes many infections. These range from mild skin infections to serious diseases like pneumonia, bone infections, endocarditis, and blood infections (Guo et al., 2020) [7] . It also lives silently in about 30% of healthy people, mostly in the nose (Liu et al., 2022) [15] . S. aureus is one of the most widespread and dangerous bacteria. It causes millions of infections worldwide each year (Liu et al., 2022) [15] . A major concern is its resistance to antibiotics. Methicillin-resistant Staphylococcus aureus (MRSA) is a major health concern. It is hard to treat because it does not respond to most penicillin-based antibiotics (Abdulrraziq et al., 2023) [2] . MRSA is found in both humans and animals. It can pass easily from one to the other. This makes control and prevention more difficult. MRSA carries a gene called mecA. This gene helps the bacteria survive many antibiotics. It produces a protein called PBP2a, which does not bind well to beta-lactam drugs (Palmieri et al., 2023) [20] . Because of this, antibiotics like methicillin and oxacillin cannot kill it. The mecA gene sits on a mobile DNA piece called SCCmec. This element can move between bacteria, spreading resistance quickly (Leseigneur et al., 2024) [13] .

S. aureus also produces many harmful molecules. These are called virulence factors. Some of them are toxins and enzymes. Examples include enterotoxins, lipases, nucleases, proteases, and staphylokinase (Yamanashi et al., 2022) [26] . These help the bacteria invade the body and avoid the immune system. Enterotoxin A (SEA) is one of the most dangerous toxins. It can cause food poisoning if the bacteria grow in food. SEA is made when a special virus, called a phage, becomes active inside the bacteria. Its production is not linked to how fast the bacteria grow or how many are present (Yamanashi et al., 2022) [26] . The nuc gene helps the bacteria escape immune traps by breaking down DNA and RNA. It is very stable and is often used to identify S. aureus in the lab (Alkhafajy & Al-Mathkhury, 2023) [3] . This gene also helps the bacteria destroy tissues and spread through the body. Lipase is another enzyme that S. aureus uses to survive. It breaks down fats in human cells. This damages tissues and helps the bacteria spread. High amounts of lipase are often found in serious MRSA infections (Kitadokoro et al., 2024) [11] . Lipase also lowers the body's immune response by destroying protective lipids. Staphylokinase plays a different role. It turns plasminogen into plasmin, a protein that breaks down blood clots. This action helps the bacteria move through tissues more easily. It also helps them avoid being trapped by immune cells (Noori & Aziz, 2020) [19] . It is also used as a drug to treat blood clots. Proteases are enzymes that cut proteins. They help bacteria damage host tissues and avoid immune responses (Marquart, 2021) [16] . In summary, S. aureus can resist many drugs and cause many kinds of disease. This study focuses on its resistance patterns and key virulence genes.

Materials and Methods

Sample Collection and Bacterial Isolation

A total of 14 samples were collected between December 1, 2022, and August 31, 2023. Seven samples came from humans through the central laboratory in Dhi Qar, and seven came from animals at a private slaughterhouse in Al-Najaf Al-Ashraf. The samples were kept in Cary-Blair transport medium (Himedia) and transported in cold boxes to the central laboratory in Dhi Qar within 24 hours. Isolation and identification began by culturing the samples on blood agar and mannitol salt agar. Both media were prepared following the manufacturer's instructions. The plates were incubated and examined using aseptic techniques. Colonies suspected to be Staphylococcus species were subjected to Gram staining using a Himedia kit, followed by biochemical tests including catalase, coagulase, and others for confirmation. Final identification was carried out using the VITEK 2 compact system at the College of Health and Medical Technologies, Islamic University, Najaf, based on instructions from the Biomerieux company.

Antibiotic Susceptibility Testing

Antibiotic resistance was tested using the disc diffusion method on Muller-Hinton agar (Himedia, India). The test followed the Clinical and Laboratory Standards Institute (CLSI) guidelines. The VITEK 2 Ast card compact system was used for additional confirmation using AST cards for Gram-positive cocci. A total of 19 antibiotics were tested, including cefoxitin, oxacillin, benzylpenicillin, erythromycin, clindamycin, gentamicin, ciprofloxacin, moxifloxacin, vancomycin, linezolid, tigecycline, teicoplanin, tetracycline, fosfomycin, fusidic acid, rifampicin, and trimethoprim/sulfamethoxazole. The results were recorded and interpreted according to the latest CLSI standards to determine resistance, intermediate, or susceptibility levels. DNA Extraction and PCR Amplification DNA was extracted using the Favorgene kit (Korea), following the manufacturer's instructions. The DNA purity and concentration were measured using a Chimadzu doublebeam spectrophotometer at the Al-Amin Research Center. The 16S rRNA gene specific for Staphylococcus was targeted using two primer sets: TStaG422/TStaG765 F (GGC CGT GTT GAA CGT GGT CAA ATC A) and R (TIA CCA TTT CAG TAC CTT CTG GTA A) for Staphylococcus genusspecific detection with 370 bp amplicon and universal 27F/1492R primers F(AGAGTTTGATCCTGGCTCAG) and R (TACGGYTACCTTGTTACGACT) for Staphylococcus genus-universal detection with 1468 bp amplicon. PCR was done using 2 µL of extracted DNA with Promega Green Master Mix on an Agilent thermocycler. The thermal cycling conditions were: 94 °C for 2 minutes (initial denaturation), followed by 30 cycles of 94 °C (Denaturation) for 30 seconds, 57 °C (Annealing) for 30 seconds, and 72 °C(extension) for 1 minute, then (a final extension) at 72 °C for 5 minutes. Products were visualized using 1.5% agarose gel electrophoresis with RedSafe dye and photographed under UV light.

Virulence Gene Detection

PCR was also used to detect specific virulence genes in S. aureus isolates. The genes included mecA (533 bp), nuc (537 bp), lipase (921 bp), staphylokinase (492 bp), invasive protease (723 bp), and enterotoxin A (521 bp). The amplification protocol was similar to the one used for 16S rRNA. PCR products were run on 1% agarose gel and visualized using gel documentation systems. The presence or absence of these virulence genes was recorded for each isolate. [8] sea (EnterA)-R GTTCTGTAGAAGTATGAAACACG

Electrophoresis and Visualization

After PCR, gels were prepared by dissolving 1 gram of agarose in 100 mL of 1X TBE buffer. The solution was microwaved for 1 minute and cooled to about 50°C. Then 0.5 µL of RedSafe dye was added. The gel was poured into a tray and combs were inserted to form wells. After solidification, the DNA samples were loaded and run using electrophoresis. Bands were observed using a gel documentation system from Cleaver Scientific (USA) to confirm the size and presence of target genes.

Statistical Analysis

All collected data were analyzed using SPSS software and Microsoft Excel. Data were expressed as mean ± standard deviation error (SDE). A P-value ≤ 0.05 was considered statistically significant, indicating real differences between the observed values.

Phylogenetic Analysis

The evolutionary relationships of the isolates were analyzed using the Neighbor-Joining (NJ) method (Saitou & Nei, 1987) [21] through MEGA11 software (Tamura et al., 2021) [23] . The evolutionary distances were computed with the Maximum Composite Likelihood method (Tamura et al., 2004) [24] . Bootstrap analysis was conducted with 1000 replicates (Felsenstein, 1995) [5] . Poorly aligned regions were removed using the pairwise deletion option. The final dataset included 887 nucleotide positions. This method helped illustrate genetic diversity and clustering patterns among the S. aureus isolates.

Results

Phenotypic and Biochemical Identification

Out of 14 collected samples, 5 were confirmed as

Staphylococcus aureus, representing 35.7% of the total. Gram staining showed Gram-positive cocci arranged in irregular grape-like clusters. On Baird-Parker agar, colonies appeared jet-black with clear white halos. Biochemical tests confirmed the identity of the isolates. All five tested positives for catalase, coagulase, DNase, and acetoin production. The oxidase test was negative for all isolates. These results matched the typical characteristics of S. aureus. The VITEK 2 system also confirmed these identifications, providing automated validation based on metabolic profiles. Overall, the phenotypic features and biochemical reactions supported the classification of these isolates as S. aureus. Additional PCR tests were done to detect virulence and resistance genes. The mecA gene was detected in 3 out of 5 isolates (60%) as show in (table 3), confirming methicillin resistance. The nuc gene, known for being a stable diagnostic marker, was found in 4 isolates (80%) as show in (table 3). All five isolates (100%) tested positive for lipase as show in (table 3), staphylokinase, and Enterotoxin A genes. Invasive protease genes were detected in 3 isolates (60%) as show in (table 3). These results showed that S. aureus isolates from both human and animal samples carried multiple virulence genes, some of which are involved in antibiotic resistance and immune evasion. 3, the symbol F refers to the word Frequency, the symbol % refers to the percentage, the symbol + refers to the word positive, and the symbol -refers to the word negative.

Antibiotic Susceptibility Testing

All five isolates underwent antibiotic sensitivity testing against 19 antibiotics using both disc diffusion and the VITEK 2 system. The results showed high resistance to βlactam antibiotics. Specifically, resistance to benzylpenicillin was found in 84.2% of isolates, oxacillin and cefoxitin screen each in 73.7%. These findings confirm the presence of MRSA strains. Moderate resistance was observed for clindamycin (31.6%), erythromycin (26.3%), and inducible clindamycin resistance (26.3%). Low resistance was found for rifampicin (10.5%), tetracycline (5.3%), and trimethoprim /sulfamethoxazole (5.3%). Several antibiotics showed 100% sensitivity, including gentamicin, ciprofloxacin, moxifloxacin, linezolid, tigecycline, teicoplanin, fusidic acid, and fosfomycin. Vancomycin showed 94.7% sensitivity, with one isolate showing intermediate resistance. These results suggest that although MRSA strains are present, several antibiotics remain effective treatment options.

Phylogenetic relation ship

Phylogenetic analysis of the 16S rRNA sequences revealed genetic variation among the five S. aureus isolates. Strain NJF-42 clustered closely with strain C900, suggesting recent common ancestry. NJF-49 grouped with strain ER02360.3, forming a distinct clade and showing moderate divergence. THQR-59 was positioned near NJF-49, suggesting a related but separate evolutionary path. THQR-49 grouped with strain C12, showing very close genetic similarity based on a short branch length. In contrast, THQR-34 formed its own unique branch, far from the others, indicating the highest divergence. These clustering patterns reflect different possible origins or evolutionary paths of the isolates, some possibly linked to hospital-acquired strains (MRSA), while others may represent distinct community-acquired or animal-associated lineages.

Note:

The blue color in Figure 8 indicates the bacteria isolated and identified from the animal, while the blue color indicates the bacteria identified from the human.

Discussion

The current study confirmed the presence of Staphylococcus aureus in both human and animal samples collected from Dhi Qar and Al-Najaf. Five isolates were identified through culture, biochemical testing, and confirmed by the VITEK 2 system. The high rate of resistance to β-lactam antibiotics, especially oxacillin and cefoxitin, indicated the presence of methicillin-resistant S. aureus (MRSA) strains. This matches previous findings showing the widespread presence of MRSA in clinical and animal sources (Abdulrraziq et al., 2023) [2] . The mecA gene was detected in 60% of the Staphylococcus aureus isolates. This gene gives the bacteria strong resistance to methicillin and other beta-lactam antibiotics. It works by producing a special protein called PBP2a. This protein has low affinity for these drugs and allows the bacteria to grow even when antibiotics are present (Leseigneur et al., 2024) [13] .

These results match the high resistance found in the antibiotic sensitivity tests. The detection of mecA supports the presence of MRSA strains in both animal and human samples. MRSA is a serious problem because it spreads easily. It can move between animals and people through contact or contaminated environments. The misuse of antibiotics in livestock and veterinary practice increases this risk. Such settings create pressure that encourages the spread of resistant bacteria (Shahid et al., 2021) [23] . PCR results also showed that all isolates carried three major virulence genes: staphylokinase, lipase, and Enterotoxin A. These genes help the bacteria cause disease in many ways. Staphylokinase helps the bacteria break down blood clots. It turns plasminogen into plasmin, which allows the bacteria to move through tissues and avoid immune cells (Noori & Aziz, 2020) [19] . Lipase breaks down fats in the host's cells. This damages tissues and weakens immune defenses (Kitadokoro et al., 2020) [12] . Enterotoxin A (SEA) causes food poisoning. It is one of the most common and dangerous toxins made by S. aureus. This toxin is active even if the bacteria are not growing quickly, because it is controlled by a phage (Yamanashi et al., 2022) [26] . Finding these three genes in every isolate suggests that they are essential tools for S. aureus to survive and spread. Two other virulence genes, nuc and invasive protease, were also detected. The nuc gene was found in four isolates. It produces an enzyme that cuts DNA and RNA. This helps the bacteria escape from neutrophil traps in the body. Because of its stability, the nuc gene is often used to confirm S. aureus in the lab (Alkhafajy & Al-Mathkhury, 2023) [3] . The invasive protease gene was found in three isolates. It helps the bacteria destroy host tissues and weaken the immune system (Marquart, 2021) [16] . The presence of these virulence genes varied among the isolates. Some strains had more, and some had fewer. This difference could be linked to how severe the infections were or where the bacteria came from. In general, isolates with more virulence genes may be more aggressive and dangerous. The phylogenetic tree showed that the isolates were genetically different. Some isolates, like NJF-42, were closely related to known community strains such as C900. This suggests that they may have come from similar sources. Others, like THQR-34, were very different and formed their own separate group. This might mean they are part of new or uncommon strains. For example, THQR-49 and C12 were very close, while NJF-49 and THQR-59 showed moderate divergence. This diversity means that S. aureus in Iraq is not a single type. Some strains may come from hospitals, and others from the community or animal sources. Some may carry more resistance genes, while others carry different toxins. Continued gene sequencing is important to track these changes. It helps detect new threats and control the spread of dangerous strains, especially in places with strong humananimal interaction and high antibiotic use.

Conclusion

This study confirmed the presence of Staphylococcus aureus in both humans and animals in southern Iraq. Out of 14 samples, five were identified as S. aureus. Most of these showed strong resistance to key antibiotics, especially betalactams. The mecA gene, which causes methicillin resistance, was found in 60% of the isolates. All five isolates carried important virulence genes like staphylokinase, lipase, and Enterotoxin A. Other genes like nuc and invasive protease were also common. These genes help the bacteria enter tissues and avoid the immune system. Phylogenetic analysis showed that the isolates came from different genetic lines. This suggests that they may have different sources and could spread between animals and humans. These results show the need for responsible antibiotic use and regular monitoring of resistant S. aureus strains in both public health and veterinary settings.

References

1. Al-Daraghi A. Molecular detection of medA virulence gene in Staphylococcus aureus isolated from Iraqi patients. Iraqi J Biotechnol. 2022;21(1):8-18.
2. Abdulrraziq AA, Salih SM, Ibrahim N. Biological effect of Oxalis per-carpes extracts against methicillin-resistant Staphylococcus aureus (MRSA). Pharm Biosci J. 2023;11(1):1-6. https://doi.org/10.20510/pbj/11/i1/2313
3. Alkhafajy RTA, Al-Mathkhury HJF. Gentamicin upregulates the gene expression of hla and nuc in Staphylococcus aureus. Iraqi J Sci. 2023;64(3):10791092. https://doi.org/10.24996/ijs.2023.64.3.5
4. Alkuraythi DM, Alkhulaifi MM, Binjomah AZ, Alarwi M, Mujallad MI, Alharbi SA, et al. Comparative genomic analysis of antibiotic resistance and virulence genes in Staphylococcus aureus isolates from patients and retail meat. Front Cell Infect Microbiol. 2023;13:1-17. https://doi.org/10.3389/fcimb.2023.1339339
5. Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39(4):783791.
6. Frey Y, Rodriguez JP, Thomann A, Schwendener S, Perreten V. Genetic characterization of antimicrobial resistance in coagulase-negative staphylococci from bovine mastitis milk. J Dairy Sci. 2013;96(4):2247-57. https://doi.org/10.3168/jds.2012-6091
7. Guo Y, Song G, Sun M, Wang J, Wang Y. Prevalence and therapies of antibiotic-resistance in Staphylococcus aureus. Front Cell Infect Microbiol. 2020;10:1-11. https://doi.org/10.3389/fcimb.2020.00107
8. Hammer P, Jordan J, Jacobs C, Klempt M. Characterization of coagulase-negative staphylococci from brining baths in Germany. J Dairy Sci. 2019;102(10):8734-8744. https://doi.org/10.3168/jds.2018-15610
9. Jasim HY, Othman RM, Shaker WM. Association of Staphylococcus aureus with ruminant mastitis. Adv Anim Vet Sci. 2024;12(7):1348-1355.
10. Ibraheim HK, Fayez RA, Jasim AS, Gharban HAJ. Role of nuc gene in Staphylococcus aureus to phagocytic activity in different cattle infections. Open Vet J. 2023;13(8):1021-1026. https://doi.org/10.5455/OVJ.2023.v13.i8.8
11. Kitadokoro J, Kamitani S, Okuno Y, Hikima T, Yamamoto M, Hirokawa T, et al. Crystal structure of Staphylococcus aureus lipase complex with unsaturated petroselinic acid. FEBS Open Bio. 2024;14(6):942-954. https://doi.org/10.1002/2211-5463.13808
12. Kitadokoro K, Tanaka M, Hikima T, Okuno Y, Yamamoto M, Kamitani S. Crystal structure of pathogenic Staphylococcus aureus lipase complex with the anti-obesity drug orlistat. Sci Rep. 2020;10(1):3-7. https://doi.org/10.1038/s41598-020-62427-8
13. Leseigneur C, Mondange L, Pizarro-Cerdá J, Dussurget O. Staphylococcus aureus NAD kinase is required for envelope and antibiotic stress responses. Microbes Infect. 2024;26(4):105334. https://doi.org/10.1016/j.micinf.2024.105334
14. Lin T, Li Q, Jin D, Liu W, Tang C, Zhang X. Investigation of virulence genes of Staphylococcus aureus isolated from sterile body fluid samples and their correlation with clinical symptoms and outcomes. Can J Infect Dis Med Microbiol. 2021;2021:1-8. https://doi.org/10.1155/2021/5354747
15. Liu L, Wang B, Yu J, Guo Y, Yu F. NWMN2330 may be associated with the virulence of Staphylococcus aureus by increasing the expression of hla and saeRS. Infect Drug Resist. 2022;15:2853-64. https://doi.org/10.2147/IDR.S365314
16. Marquart ME. Pathogenicity and virulence of Streptococcus pneumoniae: cutting to the chase on proteases. Virulence. 2021;12(1):766-787. https://doi.org/10.1080/21505594.2021.1889812
17. Martineau F, Picard J, Ke D, Paradis S, Roy PH, Ouellette M, et al. Development of a PCR assay for identification of staphylococci at genus and species levels. J Clin Microbiol. 2001;39(7):2541-2547. https://doi.org/10.1128/JCM.39.7.2541
18. Mohammed NR, Al-Awadi SJ. Cloning of mutant staphylokinase by novel cloning vector M13 and PET32a from mutant Staphylococcus aureus and role in medical applications. Ann Trop Med Public Health. 2021;24(5):77-93. https://doi.org/10.36295/asro.2021.24512
19. Noori HA, Aziz GM. Purification, characterization, and evaluation of fibrinolytic activity of staphylokinase from locally isolated Staphylococcus aureus GH38. Iraqi J Agric Sci. 2020;51(4):1195-203. https://doi.org/10.36103/ijas.v51i4.1098
20. Palmieri A, Martinelli M, Pellati A, Carinci F, Lauritano D, Arcuri C, et al. Prevalence of Enterococci and vancomycin resistance in the throat of non-hospitalized individuals randomly selected in Central Italy. Antibiotics. 2023;12(7):1-8. https://doi.org/10.3390/antibiotics12071161
21. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406-425. https://doi.org/10.1093/oxfordjournals.molbev.a040454
22. Sauer P, Gallo J, Kesselová M, Kolár M, Koukalová D. Universal primers for detection of common bacterial pathogens causing prosthetic joint infection. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2005;149(2):285-288. https://doi.org/10.5507/bp.2005.043
23. Shahid AH, Nazir KH, El Zowalaty ME, Kabir A, Sarker SA, Siddique MP, et al. Molecular detection of vancomycin and methicillin resistance in Staphylococcus aureus isolated from food processing environments. One Health. 2021;13:100276. https://doi.org/10.1016/j.onehlt.2021.100276
24. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci U S A. 2004;101(30):11030-11035. https://doi.org/10.1073/pnas.0404206101
25. Tamura K, Stecher G, Kumar S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38(7):3022-3027. https://doi.org/10.1093/molbev/msab120
26. Yamanashi Y, Shimamura Y, Sasahara H, Komuro M, Sasaki K, Morimitsu Y, et al. Effects of growth stage on the characterization of enterotoxin A-producing Staphylococcus aureus-derived membrane vesicles. Microorganisms. 2022;10(3):1-18. https://doi.org/10.3390/microorganisms10030574