Cry gene profiling of PDKV Bacillus thuringiensis strains for specificity to Pectinophora gossypiella (Saunders)

Introduction

India is predominantly an agriculture-based country. Despite the availability of advanced technologies in the agricultural sector, the yield and productivity of agricultural and horticultural crops are considerably influenced by both biotic and abiotic stresses. Among the biotic factors, insect pests are a major contributor to crop damage, accounting for an estimated 15.7% loss in yield (Dhaliwal et al., 2015) [6] . Several microorganisms induce toxins that can be used to control the pathogenicity of a wide range of plant pathogens. Bacillus thuringiensis (Bt) is widely regarded as the most effective insect-pathogenic bacterium used in pest control, representing about 2% of the overall insecticide market (Thilagarajan et al., 2023) [12] . It is a Gram-positive, aerobic, spore-forming bacterium that inhabits the soil and is well known for producing insecticidal crystal proteins, termed δendotoxins (delta-endotoxins), during sporulation. The taxonomic classification of these toxins placed them in the delta class of insecticidal toxins due to their intracellular localization. They are considered the main factor conferring entomopathogenic properties to Bt (Bouslama et al., 2020) [4] . δ-endotoxins of Bacillus thuringiensis act by forming pores in the midgut epithelial membranes of insects, leading to cell lysis. These toxins have a threedomain structure: Domain I forms pores in the epithelial cell membranes. Domain II binds to specific receptors, and Domain III stabilizes the toxin-receptor interaction, causing osmotic imbalance and insect death. Therefore, it is evident that the three domains of the toxin protein function in a coordinated manner, with their activities complementing each other (Melo et al., 2016) [8] . To date, over 500 Bt toxin genes have been identified and classified into 72 classes based on amino acid sequence similarity and insecticidal specificity (Crickmore et al., 1998) [5] . Among these, only a limited number of Cry toxins are widely utilized for pest control. Notably, Cry1, Cry2, Cry9, and Vip3A proteins have shown toxicity and specificity against various lepidopteran insect pests. However, prolonged use of Bt toxins has led to the development of resistance in target insect pests (Hassan et al., 2021) [7] . The continuous exploration of Bacillus thuringiensis strains producing diverse toxins is essential for identifying novel and effective isolates.

To determine their potential against insect pests, these isolates must be characterized and screened for the presence of insecticidal genes. Thus, offers promising strategy to overcome resistance to known Bt biopesticides. Polymerase Chain Reaction (PCR) is a highly efficient method for characterizing Bt genes. It enables rapid and accurate detection of specific DNA sequences using minimal DNA, allowing large-scale screening of Bt isolates to identify and map novel cry-type genes. The use of universal primers is a widely adopted method for detecting the presence of cry genes (Hassan et al., 2021) [7] . In the present investigation 10 PDKV Bt isolates along with standard Bacillus thuringiensis kurstaki HD-1 and B. crereus have been screened for the presence of cry genes which are toxic to Pectinophora gossypiella (Saunders).

Materials and Methods

Bt culture

A total of 10 PDKV Bt isolates (PDKV SA-20, PDKV SY-4, PDKV SGd-1, PDKV SA-6, PDKV SA-18, PDKV SBn-2, PDKV SAk-6, PDKV SAk-9, PDKV SGn-4 and PDKV SGn-5) were obtained from Department of Entomology, Dr. PDKV, Akola, India. Along with standard Btk HD-1 and B. cereus strain was obtained from NCIM. A single colony of Bt cultures was inoculated into 50 ml of Luria broth and incubated at 30 °C overnight at 200 rpm.

Plasmid DNA isolation

Overnight grown culture of Bt isolates was centrifuged at 10,000 rpm for 2 minutes to harvest the cells. Plasmid DNA from the Bt isolates was extracted as per the standard protocol of HiPurA plasmid DNA purification kit.

PCR Screening 2.3.1 PCR primers

The 10 promising PDKV Bt isolates along with standard Btk HD-1 and B. cereus strain were screened for the presence of 4 cry genes cry1, cry1Ac, cry2Ab and cry9 which are toxic to pink bollworm. The details of the sequences, gene recognized, and the predicted amplicon size of the cry genes are presented in (Table 1).

5' GTTTGAGCCGCTTCACAGCAATCC 3' F-Forward sequence of primer; R-Reverse sequence of primer

Amplification reaction mixture

Isolated plasmid DNA was used as a template DNA for the amplification of cry1, cry1Ac, cry2Ab and cry9 genes with their specific primers. A total reaction volume of 20 µl consists of 2 µl of template DNA, 1 μl of each primer (forward and reverse), 10 µl of PCR master mix (Make: Takara) consisting of dNTPs, Taq polymerase, and 6 µl of nuclease-free water as given in (Table 2).

DNA amplification

PCR analysis was performed in thermal cycler (Prima-Trio TM ) following a temperature cycling program as described by (Temnykh et al., 2000). The temperature profile of the PCR for screening the Bt isolates for the presence of cry1, cry1Ac, cry2Ab and cry9 genes are given (Table 3). The amplification was performed with an initial denaturation at 94 °C for 4 minutes, followed by 30 cycles consisting of denaturation at 94 °C for 1 minute, annealing for 1 minute (at the appropriate annealing temperature), and extension at 72 °C for 1 minute. This was followed by a final extension at 72 °C for 7 minutes and a final hold at 4 °C. The PCR products were resolved by electrophoresis on a 2% agarose gel stained with ethidium bromide (EtBr). The amplified DNA bands were visualized under a UV trans illuminator and documented (Bio-Print, Vilber).

Results and Discussion

The 10 most potent isolates, based on their entomopathogenic activity against the test insect Pectinophora gossypiella, were selected for screening for the presence of different cry genes (cry1, cry1Ac, cry2Ab and cry9) along with the standard Btk HD-1and B. cereus strain. The cry gene profile of PDKV Bt isolates is present in (Table 4 and5) depicted in Fig 1 . Among the four cry gene primers employed in the present study, cry1 was the most prevalent, present in nine PDKV Bt isolates-SA-6, SA-18, SA-20, SAk-6, SAk-9, SGd-1, SGn-4, SGn-5, and SBn-2 as well as in the reference strain HD-1. The cry1Ac gene was amplified in six isolates: SA-6, SA-20, SAk-6, SAk-9, SGd-1, and SGn-5. The cry2Ab gene was present in five strains: HD-1, SY-4, SAk-6, SGn-4, and SGn-5. In contrast, none of the tested isolates showed amplification for the cry9 gene, indicating its absence in the strains screened. The present studies are consistent with earlier findings by Naik et al. (2018) [9] and Pooja et al. (2013) [10] .

Conclusion

The present study highlights the genetic diversity among Bacillus thuringiensis isolates, particularly in the distribution of cry and vip genes, which are directly associated with their insecticidal potential. The variability in cry-type genes underscores the importance of molecular characterization in identifying promising Bt strains. These findings provide a valuable foundation for selecting potent Bt isolates for the development of biopesticides and for the isolation of insecticidal genes that can be utilized in the creation of insect-resistant transgenic crops, contributing to sustainable pest management strategies.

Acknowledgement

AcknowledgementThe authors are thankful to Department of Entomology, Post Graduate Institute, Dr. PDKV, Akola, Maharashtra, India for providing all the necessary facilities for conducting the present research work. They are also thankful to the Rajiv Gandhi Science and Technology commission, Mumbai (MS) for funding a Bt project at Biotech Centre, Dr. PDKV, Akola (MS) since the experiment was conducted there.

References

1. Alberola TM, Aptosoglou S, Arsenakis M, Bel Y, Delrio G, Ellar DJ, et al. Insecticidal activity of strains of Bacillus thuringiensis on larvae and adults of Bactrocera oleae Gmelin (Dipt. Tephritidae). Journal of Invertebrate Pathology. 1999;74(2):127-136.
2. Arulselvi PI, Udayasuriyan V, Sangeetha S. Identification of three cry2A genes in an indigenous Bacillus thuringiensis strain. Journal of Biopesticides. 2011;4(1):56-60.
3. Ben-Dov E, Zaritsky A, Dahan E, Barak Z, Sinai R, Manasherob R, et al. Extended screening by PCR for seven cry-group genes from field-collected strains of Bacillus thuringiensis. Applied and Environmental Microbiology. 1997;63(12):4883-4890.
4. Bouslama T, Chaieb I, Rhouma A, Laarif A. Evaluation of a Bacillus thuringiensis isolate based formulation against the pod borer, Helicoverpa armigera Hübner (Lepidoptera: Noctuidae). Egyptian Journal of Biological Pest Control. 2020;30:16-22.
5. Crickmore N, Zeigler DR, Feitelson J, Schnepf E, Vanrie J, Lereclus D, et al. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiological Reviews. 1998;62(3):807-813.
6. Dhaliwal GS, Jindal V, Mohindru B. Crop losses due to insect pests: Global and Indian scenario. Indian Journal of Entomology. 2015;77(2):165-168.
7. Hassan AA, Youssef MA, Elashtokhy MMA, Ismail IM, Aldayel M, Afkar E. Isolation and identification of Bacillus thuringiensis strains native of the Eastern Province of Saudi Arabia. Egyptian Journal of Biological Pest Control. 2021;31:6.
8. Melo AL, Soccol VT, Soccol CR. Bacillus thuringiensis: mechanism of action, resistance, and new applications: a review. Critical Reviews in Biotechnology. 2016;36:317-326.
9. Naik VCB, Kb S, Kranthi S, Nagrare VS, Kumbhare S, Gokte-Narkhedkar N, et al. Pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) survival on transgenic cotton in India. Egyptian Journal of Biological Pest Control. 2021;31(1):40.
10. Pooja AS, Krishnaraj PU, Prashanthi SK. Profile of cry from native Bacillus thuringiensis isolates and expression of cry1I. African Journal of Biotechnology. 2013;12:3545-3562.
11. Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L. Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theoretical and Applied Genetics. 2000;100:697-712.
12. Thilagarajan R, Balakrishnan N, Rajadurai G, Venugopal S, Raghu R, Kokiladevi E. Characterization of indigenous Bacillus thuringiensis (Bt) isolates and screening for lepidopteran toxic insecticidal genes. The Pharma Innovation Journal. 2023;SP-12(9):1691-1694.