Investigation sheeppox outbreak in migratory flock of Mouli sheep in Karnataka

Introduction

Sheeppox is a highly contagious disease, that spreads mostly by direct contact with lesions or contaminated feed, fodder, water and wool (Manjunatha Reddy et al., 2024a) [4] . Virus is excreted in the nasal, ocular secretions, milk and possibly through urine. The common practice of migration in search of water and fodder for long routes leads to wading of sheep to nibble leaves through bushes and thorny plants damages the skin and facilitating the disease transmission from the infected to the susceptible animals. Furthermore, these areas are easily accessible to biting flies (mechanical carriers), which can easily bite, suck blood and transmit the virus. Stomoxys calcitrans is an efficient mechanical vector of Capripox virus (Kitching and Taylor, 1985) [3] . The incubation period of sheeppox and goatpox is between 8-13 days. Exotic breeds and young animals are more susceptible and may die of acute infection before the development of skin lesions than indigenous and adult animals, which show different stages of disease manifestations such as a rise in rectal temperature to more than 40 °C, followed by development of macules, small circumscribed areas of hyperemia, which are most obvious on unpigmented skin in the initial 2-5 days, followed by appearance of papules, hard swellings of 0.5 and 1 cm in diameter which may cover the body or be restricted to the groin, axilla and perineum. Rarely papules may be covered by fluid-filled vesicles, but this is rare (Zro et al., 2014; Manjunatha Reddy et al., 2024a) [12,4] . Diagnosis of the disease is mainly by the clinical signs and post mortem lesions. Confirmatory diagnosis is done by partial Polymerase Chain Reaction (Sumana et al., 2020a) [9] . Present paper reports the outbreak of sheeppox occurred in the border region of Kalaburagi and Vijayapura districts of Karnataka state. were collected and transported to laboratory.

Materials and Methods

History of outbreak and sample collection

Processing of samples Tissue/scab

Tissue was sliced into small pieces using a sterile BP blade and triturated with the help of mortar and pestle with 2 ml of chilled 1X PBS. About 200 μl of each tissue suspension was added to the 2 ml microcentrifuge tubes having 200 μl of buffer ATL and 20 μl of K. The samples were vortexed and incubated at 56 °C for 10 min or till the samples were completely lysed. Then the samples were vortexed for 15 seconds before further proceeding for DNA extraction.

Processing of blood sample. Fifty microlitre of whole blood was transferred to 2 ml microcentrifuge tubes, 20 μl of proteinase K and 150 μl 1X

PBS was added to all the tubes to make total volume to 220 μl for each sample. To this mixture, 200 μl of buffer ATL was added, the samples were vortexed and incubated at 56 °C for 10 min or till the samples were completely lysed. Then samples were vortexed for 15 seconds before proceeding for DNA extraction.

Processing of nasal swab samples

Swab samples were mixed with one ml of 1X PBS, 200 μl of samples were transferred to 2 ml microcentrifuge tubes and 20 μl of proteinase K was added then the samples were vortexed for 15 seconds before proceeding for DNA extraction. DNA extraction was done using DNeasy blood and tissue kit (QIAGEN, Germany). The purity of extracted DNA was checked by using spectrophotometer (Nano Drop-1000).

Polymerase Chain Reaction

The PCR was carried out using the primers P32-F 5 ' ACACAGGGGGATATGATTTTACC 3' and P32 R-5' ATACCGTTTTTCATTTCGTTAGC 3' (Reddy et al.,

2015) [8] and RPO30 gene-based species-specific primers (Sumana et al., 2020a) [9] . A PCR reaction was set to a volume of 25 μl using Taq PCR master mix (QIAGEN, Germany) with initial denaturation at 94 °C for 5 min, then 94 °C for 30 sec, 52 °C for 30 sec and 72 °C for 45 seconds for 35 cycles. And final extension of 72 °C for 10 min in thermal cycler (PeQ Star2x, Eppendorf). The PCR product was subjected to agarose gel electrophoresis and photographs were documented (GelDock: Box, Syngene, India).

Results and Discussion

The sheeppox outbreak in May 2024 in a migratory sheep flock of 35 nos, Mouli breed at the border of Kalaburagi and Vijayapura districts had a morbidity of 42 percent and case fatality rate of 100 percent. Clinical symptoms such as high fever, nasal discharge, swollen eyelid and head with generalized pox lesions on the entire body. These clinical signs were variable according to the form of the disease. In the malignant form that generally seen in young ones, wherein the body temperature may shoot up to 40-42 °C with dyspnoea and oculo-nasal discharge and pox lesions on un-wooled skin, whereas in benign form only skin lesions occur particularly under the tail (Hurisa et al., 2018; Manjunatha Reddy et al., 2017) [2,6] . Post-mortem examination of the dead animals revealed pock lesions in lungs and liver (Fig. 1). Similar observations were also reported by (Bowden et [1,7,6,5] .

(A) (B) The animals during the course of their migration might have picked p the infection by ingesting Pasteur/water contaminated with SPV. We learnt that the flock was an unvaccinated one. During the investigation, we also learnt that these shepherds throw away the sheep that died due to sheeppox which could be a potential source of infection to any other flocks following the same path.

Although sheeppox can be diagnosed by pathognomonic clinical signs and lesions, further confirmation of the disease was done by PCR targeting the partial P32 gene of SPV from skin scab, nasal swab and PM samples. All the samples were found positive with an expected amplicon size of 237 bp on agarose gel electrophoresis (Fig. 2). Thus confirming the virus belonging to the genus Capripox (Reddy et al., 2015; Sumana et al., 2020b) [8,10] . Capripox viruses are considered to be species specific (Tulman et al., 2002) [11] and in the present investigation too the affected host was sheep and the disease was confirmed as sheeppox.

Conclusion

The sheeppox outbreak reported in May 2024 in a migratory flock of Mouli sheep in northern Karnataka highlights the significant impact of the disease, particularly in unvaccinated populations. With a morbidity rate of 42% and a case fatality rate of 100%, the outbreak emphasized the need for preventative measures such as vaccination. The clinical symptoms, post-mortem findings, and PCR analysis confirmed the presence of the Capripoxvirus, specifically sheeppox. The unvaccinated flock's exposure to contaminated environments and improper disposal of infected carcasses likely facilitated the spread of the virus. This outbreak underscores the importance of vaccination and proper biosecurity measures to control the spread of sheeppox.

Acknowledgement

AcknowledgmentsThe authors acknowledge the support rendered by Dean, Veterinary College, Hebbal, Head, Department of Veterinary Microbiology, and Director of ICAR-National Institute of Veterinary and Disease Informatics (NIVEDI), Bengaluru, Karnataka, for providing

References

1. Bowden TR, Babiuk SL, Parkyn GR, Copps JS, Boyle DB. Capripoxvirus tissue tropism and shedding: A quantitative study in experimentally infected sheep and goats. Virology. 2008;371(2):380-393.
2. Hurisa TT, Jing Z, Jia H, Chen G, He XB. A Review on Sheeppox and Goatpox: Insight of Epidemiology, Diagnosis, Treatment and Control Measures in Ethiopia. Journal of Infectious Diseases and Epidemiology. 2018;4:057.
3. Kitching RP, Taylor PW. Transmission of Capripoxvirus. Research in Veterinary Science. 1985;39:196-199.
4. Manjunatha Reddy GB, Sumana K, Yogisharadhya R, Mohan HV, Lavanya VK, Chethankumar BH, et al. Structural and sequence analysis of the RPO30 gene of sheeppox and goatpox viruses from India. Veterinary Quarterly. 2024(a);44(1):1-12.
5. Manjunatha Reddy GB, Krishnappa VK, Siddalingaiah CD, Rao S, Nayakvadi S, Harlipura Basavarajappa CK, et al. Epidemiological, pathological, and molecular studies on sheeppox disease outbreaks in Karnataka, India. Microorganisms. 2024(b);12:1373.
6. Manjunatha Reddy GB, Sumana K, Apsana R, Yogisharadhya R, Prajapati A, Patil SS, et al. Investigation of malignant form of sheep pox outbreak in fattening lambs in Mandya, Karnataka. Indian Journal of Veterinary Pathology. 2017;41:184-188.
7. Rather MA, Ahanger SA, Raheeqa Razvi M, Maroof Shah TA, Mir DM, Para IH, et al. Outbreak of sheep pox among cross-breed sheep in Kashmir valley. Pharma Innovation Journal. 2020;9:50-53.
8. Reddy GBM, Sumana K, Babu S, Yadav J, Balamuragan V, Hemadri D, et al. Pathological and molecular characterization of Capripoxvirus outbreak in sheep and goats in Karnataka. Indian Journal of Veterinary Pathology. 2015;39(1):11.
9. Sumana K, Yogisharadhya R, Sathish BS, Dipti M, Apsana R, Saminathan M, et al. Molecular phylogeny of Capripoxviruses based on major immunodominant protein (P32) reveals circulation of host-specific sheeppox and goatpox viruses in small ruminants of India. Infection, Genetics and Evolution. 2020(a);85:104472.
10. Sumana K, Revanaiah Y, Apsana R, Roy P, Manjunatha Reddy GB. Molecular characterization of sheeppox virus from outbreaks in Karnataka, India. Veterinary World. 2020(b);13(2):386-391.
11. Tulman ER, Afonso CL, Lu Z. The genomes of sheeppox and goatpox viruses. Journal of Virology. 2002;76:6054-6061.
12. Zro K, Azelmat S, Bendouro Y, Kuhn JH, El Fahime E, Ennaji MM. PCR-based assay to detect sheeppox virus in ocular, nasal, and rectal swabs from infected Moroccan sheep. Journal of Virological Methods. 2014;204:38-43.